use of cytotoxic t cells against minor histocompatibility antigens

... p672) used in the study were promiscuous Ex Vivo Cytotoxicity of In Vivo Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination ... concluded that hTERT p540 is not expressed or is cryptic on the surface of tumour cells and that immunization of cancer patients with hTERT p540 leads to the production of T cells that not recognize tumour ... with hTERT-pulsed DCs homing of the tumour-specific T cell populations to tumour sites contributes to the effectiveness of the antitumour immunity generated [85] Unfortunately, due to the limited...

Ngày tải lên: 18/06/2014, 15:20

... treatment decreases the infiltrate in joints Furthermore, RA patients relapse shortly after withdrawal of anti-TNF-α [19] and thus, despite the dampening of joint inflammation and the reinstatement of ... active RA before treatment with anti-TNF-α were unable to suppress proinflammatory cytokine secretion from activated T cells and monocytes After anti-TNF-α treatment the ‘hibernated’ peripheral ... obvious restrictions because access to the inflamed tissues or regional lymph nodes is often impracticable The present study also indicates that, despite the localized accumulation at the site of inflammation,...

Ngày tải lên: 09/08/2014, 06:23

... directly to DCs may a new alternative of therapies for patients with allergic asthma These findings suggest that spleen DCs and Foxp3+Tregs prevents the generation and activation of Th2 effector cells ... et al Genetic Vaccines and Therapy 2010, 8:2 http://www.gvt-journal.com/content/8/1/2 A great number of studies have shown that the targeting of antigens to DC surface receptors elicits effective ... mature phenotype and express a range of co-stimulatory molecules that are intermediate between immature and mature DCs, resulting in tolerogenic interaction with T cells in SIT We found that the...

Ngày tải lên: 14/08/2014, 19:22

... respectively The NFAT-Luc reporter was constructed by inserting an oligonucleotide encoding the NFAT binding site of the FasL promoter (5¢-ATTGTGGGCGGAAACTTCCAG-3¢) with additional GATC motifs at the ... line that was stably transfected with the NFATZH reporter construct (Oum, J.-H & Park, J., unpublished results) The reporter construct contained three copies of the distal NFAT binding site in the ... luciferase reporter system containing the 2.3-kb genomic DNA fragment that is sufficient for transcriptional activation of the FasL gene [22] Transient transfection of the reporter into Jurkat cells produced...

Ngày tải lên: 24/03/2014, 03:21

... 5’-AGA TCC TGC ACA GGA CTG TG-3’ for CCL8; 5’-AGG GCA TGG GTT TTA TTA TAT ATA TAT-3’ and 5’-TTT AAA AAT AAC TGA TAT TCA TGG-3’ for CCL11; 5’-TCA TCT TTC CAC AAT AAC ATA TTT A-3’ and 5’-GTT TAT TTG ... AGT ATT GCT GAT CTT T- 3’ for CCL13; 5’-GGA CTT CCT GGA TCC TCC TC-3’ and 5’-AGC AGT CAG CAG CAA AGT GA-3’ for CCL15; 5’-ATG GCC CTG CTA CTG GCC CTC AGC CTG-3’ and 5’- TTA ACT GCT GCG GCG CTT ... limited ability of T cells to infiltrate tumors in vivo ([29,30]) Chemokines fused to anti-tumor Ab may be utilized to attract adoptively transferred tumor antigen (Ag) -specific T cells to the tumor...

Ngày tải lên: 18/06/2014, 19:20

... 5’-AGA TCC TGC ACA GGA CTG TG-3’ for CCL8; 5’-AGG GCA TGG GTT TTA TTA TAT ATA TAT-3’ and 5’-TTT AAA AAT AAC TGA TAT TCA TGG-3’ for CCL11; 5’-TCA TCT TTC CAC AAT AAC ATA TTT A-3’ and 5’-GTT TAT TTG ... AGT ATT GCT GAT CTT T- 3’ for CCL13; 5’-GGA CTT CCT GGA TCC TCC TC-3’ and 5’-AGC AGT CAG CAG CAA AGT GA-3’ for CCL15; 5’-ATG GCC CTG CTA CTG GCC CTC AGC CTG-3’ and 5’- TTA ACT GCT GCG GCG CTT ... limited ability of T cells to infiltrate tumors in vivo ([29,30]) Chemokines fused to anti-tumor Ab may be utilized to attract adoptively transferred tumor antigen (Ag) -specific T cells to the tumor...

Ngày tải lên: 20/06/2014, 03:20

... et al, Regulatory T Cells in the Context of Allergic Disease thus preventing the activation of mast cells and basophils IgG4 has been shown to reduce the IgE-mediated degranulation of these cells ... required to elucidate the in vivo role of these cells and their subsets Effects of SIT on Dendritic Cells To understand the mechanisms of action of SIT, some cardinal steps should be explained The ... Treg cells, account for to 10% of peripheral CD4+ T cells and inhibit the activation of effector T cells in the periphery.38,39 FOXP3, the transcriptional regulator expressed on Treg cells, acts...

Ngày tải lên: 08/08/2014, 21:20

... suggested that the TR responses are specific for selfantigens It is thought that TR cells in mice represent those thymocytes with the highest affinity for self-peptide but that are below the threshold ... Tr1 cells [74], extends this paradigm The fate of the TR cells induced at the site is not known — whether these cells exist only transiently then die, whether they persist in the body as TR cells, ... suggests a larger question: Do TR cells represent a lineage of T cells or a state of activation that may be achieved by any T cell under the appropriate conditions of activation? The induction of TR...

Ngày tải lên: 09/08/2014, 01:24

... treated with control IgG These data imply that a substantial proportion of the T- cell compartment is still activated 14 days after intra-articular antigen challenge in the absence of Treg cells ... demonstrates that their suppressive effect is not strictly limited to autoreactive T cells Taking into consideration that Treg cells are also critically involved in the control of immune responses against ... at the site of inflammation is also an important part of the activity of Treg cells In this regard, data on the curative effects of Treg cells in experimental disease models are conflicting To...

Ngày tải lên: 09/08/2014, 06:22

... T cells to the joint in inflammatory arthritis and suggests that in the microenvironment of the joint, dysregulation of functional patterns of expression may occur Competing interests The authors ... Acknowledgements We thank the patients and their families for contributing to this study and the clinical staff for help with collection of samples We thank members of the Information Systems Unit and Statistics ... released without new protein synthesis on stimulation We have also demonstrated that several of the features of this inflammatory T cell population within the joint, such as the continued high...

Ngày tải lên: 09/08/2014, 07:20

... with CHO/EGFP cells (C) Representative FACS scatter plots of apoptotic CD3 +T cells 72 h after co-culture with CHO cells transfected with IDO (D) Representative FACS scatter plots of apoptotic ... pair: sense 5’AGATCTGCCACCATGGCACACGCTATGGAAAAC3’, and antisense 5’-GTCGACTTAACCTTCCTTCAAAAGGGATTTC-3’ The PCR products were inserted into the pMD19 -T Simple Vector (Takara) using TA-cloning procedures, ... Representative FACS scatter plots of CD3 +T cells apoptosis 72 h after culture with 200 U/ml human recombinant IL-2 (B) Representative FACS scatter plots of CD3 +T cells apoptosis 72 h after co-culture...

Ngày tải lên: 10/08/2014, 10:21

... replication DCs infected with P3 attenuated allostimulatory activities to T cells To test whether P3 infection will impair the ability of DCs to activate allogeneic naïve T cells, the direct effect ... present antigen to and activate T lymphocytes through up-regulating the expression of costimulatory and antigen presentation-associtated molecules at the mature stage [17] To examine whether the characteristics ... UV-P3-stimulated DCs did not alter the expansion of the Treg, as well as the mock-treated DCs Discussion Most studies conducted to evaluate the pathogenesis of JEV infection have noted the interaction...

Ngày tải lên: 11/08/2014, 21:21

... reactions: HsNFAT5_Fw, GGGTCAAACGACGAGATTGTG and HsNFAT5_Rv, TTGTCCGTGGTAAGCTGAGAA; HsS100A4_Fw, GTCCACCTTCCACAAGTAC TCG and HsS100A4_Rv, TCATCTGTCCTTTTCCCCAAG; and HsSLC6A12_Fw, ACACAGAGCATTGCACGGACT ... transcriptional activation of these transporters [16] Nuclear factor of activated T- cells (NFAT5) is a member of the Rel family of transcription factors [19] and targets sodium/myo-inositol cotransporter ... Windt et al Arthritis Research & Therapy 2010, 12:R100 http://arthritis-research.com/content/12/3/R100 Page of 12 Figure Hypertonic conditions activate nuclear factor of activated T- cells in osteoarthritis...

Ngày tải lên: 12/08/2014, 14:21

... TTCCATCCAGTTGCCTTCTTG (FW), GAAGGCCGTGGTTGTCACC (RE) (NM008355), IL-13: AATCTGTCTGCAGGTGGGCT (FW), GGCTTCTCACTTTCATTGGCAC (RE) (NM031168), IFNγ: AGGTGTCACAACTGCTGCCA (FW), ACACCCGAATGAGCTGCTCT (RE) ... in the experiments were as follows: GAPDH: TTGTGGAAGGGCTCATGACC (FW), TCTTCTGGGTGGCAGTGATG (RE) (NM008084), IL-2: GTCAACAGCGCACCCACTT (FW), TGCTTCCGCTGTAGAGCTTG (RE) (NM008366), IL-6: TTCCATCCAGTTGCCTTCTTG ... relation to the amplification plot of GAPDH The CT is the number of PCR cycles required for the fluorescence signal to exceed the detection threshold value The detection threshold was set to the...

Ngày tải lên: 12/08/2014, 15:21

... albeit incomplete, and have concluded that these cells represent an attempt to control active autoimmune activation [14] The size of the Treg compartment results from the combined contribution of ... suggested that CD25- Tregs correspond to activated T cells without suppressive activity [13] The other group working with treated patients has shown that the CD25- Tregs retain a suppressive function, ... events Control responder cells without Tregs showed that the CFSE - and Cell Trace Violet populations did not merge Proliferation indices, calculated as the ratios of the total gated cells at the...

Ngày tải lên: 12/08/2014, 17:22

... confirmed the authenticity of the membrane/cytosol separation In summary, these results point to functional membrane insertion of the Env-TMD-CT protein There were no obvious cytotoxic effects on the ... C-terminally truncated Env proteins Although other reasons may account for this lack of transcomplementation, the most likely explanation is that the Env-TMD-CT has to be part of the full-length Env protein ... (again the truncated gp28 band cannot be detected) This observation of gp120 incorporation into pNL-Tr712 virions stands in contrast to two studies in the literature [1,17] which report that Env...

Ngày tải lên: 13/08/2014, 09:21

... and the R system for statistical computing [27] Results Subject characteristics The subjects in this study consisted of a subset of newborns and mothers enrolled in URECA at the Boston study site ... no statistical differences in baseline characteristics of newborns with and without proliferation data (Table 1) Although of the infants were admitted to the ICU, none of them were intubated ... differences in the numbers of CD25+bright cells present in CB and PB, we next sought to establish whether or not these CD25+bright cells expressed distinct patterns of differentiation/activation markers...

Ngày tải lên: 13/08/2014, 13:22

... uninfected cells in a bystander manner (Mitrovic et al., 1994) 1.7.2 Bystander activation of T- cells Bystander activation of T cells, i.e the stimulation of unrelated, heterologous T- cells by cytokines ... deficient in CD4 T- cells are unable to mount effective cytotoxic responses as they are important for “licensing” DCs to activate the killing ability of CD8 T- cells (Bennett et al., 1998; Ridge et al., ... lymphocytes T cells provide important cell mediated immunity by participating in the cytolysis of infected cells through the recognition of antigen presented on MHC class I They so through the T cell...

Ngày tải lên: 09/09/2015, 18:58

... 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢; ... CCTCCTCACCGGATCCTCCACCTCCAGAACCACCACCCCC-3¢; primer 13, 5¢-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3¢; primer 14, 5¢-CGTCTCCTCA GGGGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3¢ In all ... study the majority of scFvs were detected in the cytosolic fraction (Fig 7A), and not in the T- cell culture supernatant (data not shown) These results indicate that the scFvs constructed with...

Ngày tải lên: 16/03/2014, 14:20

... localization of individual signaling proteins, but also to quantitatively investigate protein– protein interactions The recruitment and localization of LAT and LAT-binding proteins to the sites of receptor ... observed to localize to punctate clusters that formed immediately upon contact and were coincident with sites of tight interactions between the Jurkat T cell and the coverslip [48] These punctate clusters ... [17,22,26] These LAT tyrosines are needed for the recruitment of PLC-c1 to LAT, suggesting that the activation of PLC-c1 is crucial for the TCR-mediated stimulation of MAP kinase activity, an effect apparently...

Ngày tải lên: 23/03/2014, 15:21