update a primary key value in sql

Tài liệu Updating a Primary Key Value pdf

... Updating a Primary Key Value Problem You changed a primary key value in a DataTable and updated the change back to the underlying data source, but the value in the data source remained unchanged. ... called. To change the primary key in the table in the database, the UpdateCommand of the DataAdapter needs to locate the row based on the original primary key and update the primary key value ... need to update a primary key value in the data source underlying the DataTable. Solution Use the SourceVersion property of SqlParameter to update the primary key value in the data source....

Tài liệu Define a Primary Key and Other Indexes docx

Danh mục: Cơ sở dữ liệu

... 2.3 Define a Primary Key and Other Indexes Indexes are used to improve performance when querying data, such as searching on fields and sorting information. The primary key is an index that ensures ... hurt performance when adding and updating data. This is mainly true when importing or adding large amounts of data. The other point is that when the table is small, you can over-index as well. ... create a field that is automatically incremented, called an identity field. This identity field can also be set as the primary key field, again so that the record is made unique. The primary key...

Báo cáo y học: "Occult gallbladder carcinoma presenting as a primary ovarian tumor in two women: two case reports and a review of the literature" pot

Danh mục: Báo cáo khoa học

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Danh mục: Kỹ thuật lập trình

... made in the child DataTable. This is the default. None Indicates that no action takes place. SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in ... you change the DataColumn in the parent DataTable on which the ForeignKeyConstraint was created, then the same change is also made in any corresponding DataRow objects in the child DataTable. ... type are shown in Table 12.4. Table 12.4: Rule ENUMERATION MEMBERS CONSTANT DESCRIPTION Cascade Indicates that the delete or update to the DataRow objects in the parent DataTable are also made...

Tài liệu Adding Records with a GUID Primary Key pdf

Danh mục: Kỹ thuật lập trình

... be changed after each row is added to the table so that each row has a different GUID primary key value. This is done by handling the RowChanging event for each table. When a row has been added, ... DataRowChangeEventHandler(parentTable_RowChanging); childTable.RowChanging += new DataRowChangeEventHandler(childTable_RowChanging); } private void parentTable_RowChanging(object sender, DataRowChangeEventArgs ... The RowChanging event of the DataTable is raised when a DataRow is changing. The action that occurred on the row can be determined by the Action property of the DataRowChangingEventArgs argument...

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Danh mục: Báo cáo khoa học

... TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan probe 18S TGGACCGGCGCAAGACGGACABFig. ... kit (Stratagene, La Jolla,CA, USA). Mutagenic primers were: 5Â-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3Â andits complement for His6Ala; 5Â-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3Â and its ... rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR: primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw...

Philosophy in a New Key A Study in the Symbolism of Reason, Rite, and Art

Danh mục: Tâm lý - Nghệ thuật sống

... says, "certainly havequite elaborate 'ape-ways' into which a newcomer is graduallyacculturated, including among other patterns ways of usingavailable instruments for reaching ... fornearly a thousand years of philosophical growth, beginningwith the early Church Fathers and culminating in the greatScholastics. But, at last, its generative ideas—sin and salvation,nature and ... world is a back yard, or it may be as wide as an eagle's range and ascomplicated as a monkey's jungle preserve. That depends onthe variety of signals a creature can receive, the variety...

Expect the Unexpected: Building business value in a changing world pptx

Danh mục: Tài chính doanh nghiệp

... been taking place at several times the natural replacement rate, the amount of available arable land per person has dropped substantially and agricultural productivity has slowed.At the same ... supplies especially in Central Asia, and conversion of coral reefs to algal dominated systems.16Business is both heavily involved in causing this damage and likely to be increasingly affected ... freshwater use).5 Assessing the Erosion Nexus in a business context may generate insights such as:ã Demandandsupplystressesarelikely to be concentrated in areas such as China and India that...

Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx

Danh mục: Báo cáo khoa học

... pair(5Â-ATGGAGGCCGGAGATTTCAAAG-3Â, +1 to +22 bp;and 5Â-ACGGGCTTTAAGTATTTCATCAGGC-3Â, +1405to +1428 bp) and actin primer pair (5Â-TTCGAGCAGGAGATGGCCACC-3Â and 5Â-GAGATCCACATCTGYTGGAAGGT-3Â). ... Mishra JP, Mishra S, Gee K & Kumar A (2005) Differ-ential involvement of calmodulin-dependent proteinkinase II-activated AP-1 and c-Jun N-terminal kinase-activated EGR-1 signaling pathway in ... of armyworm larvae.Experimental proceduresAnimalsPseudaletia separata larvae were reared on an artiﬁcial dietat 25 ± 1 °C in a photoperiod of 16:8 light ⁄ dark [10]. Pen-ultimate instar larvae...

Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

Danh mục: Báo cáo khoa học

... chloroplast genome of the redalga Porphyra purpurea. PlantCell 5, 465–475.35. Kaneko, T., Tanaka, A. , Sato, S., Kotani, H., Sazuka, T.,Miyajima, N., Sugiura, M. & Tabata, S. (1996) Sequence analysisof ... K.,Kimura,T.,Kishida,Y.,Kohora,M.,Matsumoto,M.,Matsuno, A. , Muraki, A. , Nakazaki, N., Shimpo, S., Sugimoto, M., Taka-zawa, M., Yamada, M., Yasuda, M. & Tabata, S. (2001)Complete genomic sequence of the ﬁlamentous nitrogen-ﬁxingcyanobacterium ... Plant J. 15, 99–107.37. Kaneko, T., Nakamura, Y., Wolk, C.P., Kuritz, T., Sasamoto, S.,Watanabe, A. , Iriguchi, M., Ishikawa, A. , Kawashima, K.,Kimura,T.,Kishida,Y.,Kohora,M.,Matsumoto,M.,Matsuno, A. ,...

Socio-demographic characteristics of patients presenting pulmonary tuberculosis in a primary health centre, Zaria, Nigeria ppt

Danh mục: Sức khỏe giới tính

... immunization, antenatal care, postnatal, family planning and laboratory services. The study subjects include Nigerians aged 8 years and above residing in Zaria, Kaduna State, Nigeria since there ... Nigeria National Demographic Health Survey Report 2003. Nirupa CG, Sudha GT, Santha TC, Ponnuraja CR, Fathima RV, Chandrasekharan VK, Jaggarajamma K, Park K (2005). Textbook of Preventive and ... determine the socio-demographic characteristics of patients presenting with pulmonary TB (PTB) at a primary health care centre in Zaria, Kaduna State of Nigeria. STUDY POPULATION AND METHODOLOGY...

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Danh mục: Báo cáo khoa học

... utilized two acyltransferase inhibitors.SK&F 98625, originally described as a CoA-independentacyltransferase inhibitor [16], was included as it inhibitsboth LPCAT and LPAAT in MonoMac 6 cells ... thecell walls of Gram-negative bacteria, is an importantmicrobial molecular pattern that initiates in ammatoryand coagulation reactions as part of the host innate immuneresponse to infection. ... U 1A and one for TNF -a. The level of U 1A mRNA was similar in all samples asshown in Fig. 4A. This indicated equal extraction efﬁciencyand that SK&F 98625 was not a general transcriptioninhibitor....

Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Danh mục: Báo cáo khoa học

... theexperimental data was obtained as a function of time t .In these computations, the initial value for each of the rateconstants was taken f rom the corresponding slo pe of a biphasic curve (as delineated ... conđguration,the a1 b2anda2b1 contacts undergo the principal changesassociated with the cooperative oxygen binding, so thatthese are named the sliding contacts. At the a1 b1anda2b2interfaces, ... chain heterogeneity could bemaintained even in the low concentrations of hemoglobincorresponding to appreciable dissociation into a1 b1and a2 b2 dimers [5]. When the a and b chains are separatedfrom...