... Nhiệt Độ Sấy % spandex % cotton Nhiệt độ sấy tối đa 99 85 98 80 97 75 Các công đoạn Processes Chà (handsanding) Mài (Grinding) cắt rách, cào xù, nhíu (cutting, scratching, tacking)...
Ngày tải lên: 14/08/2013, 09:21
... UV combination (ozone/UV) process is applied for the reuse of sewage effluent Therefore, the aim of this study is to evaluate the effectiveness of ozone/UV process for the treatment of sewage ... ozone/UV processes were significantly effective, showing 80% reduction of A410 after 10 of run time On the other hand, the UV alone process did not show much color change Therefore, for color ... calculated by dividing A254 with DOC, are compared for the ozone alone, UV alone, and ozone/UV combination processes The ozone alone process was performed at the condition of aqueous pH and to investigate...
Ngày tải lên: 05/09/2013, 08:40
IMPROVEMENT OF BIOLOGICAL SOLUBILIZATION AND MINERALIZATION PROCESS FOR FOOD WASTE
... Yaacov, 2001) Biological solubilization and mineralization process was proposed for food wastes (Okada and Nishijima, 2001) In the process, food wastes are mixed with rice hull as biological ... oxygen for the solubilization of food waste The circulating water did not contain oxygen when aeration was not carried out in the circulation tank Therefore, oxygen would be deficient for the ... mineralization process without accumulation of food wastes and to increase mineralization rate for the reduction of organic loading to the sewerage system Biological solubilization and mineralization process...
Ngày tải lên: 05/09/2013, 08:40
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH analysis and was stored at -80oC The extraction of DNA was performed with Fast ... excess sludge Figure Bench-scale continuous activated sludge process Table Influent Composition to the Bench-Scale Simulated Activated Sludge Process RUN RUN1 RUN2 RUN3 RUN4 RUN5 RUN6 RUN DATE 2002 ... was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r GTTTGCAGCGCTTTGTACCG ( Dionishi et al., 2002) were employed for the detection...
Ngày tải lên: 05/09/2013, 09:38
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater
... Therefore, the land area requirement could be significantly reduced and accordingly construction investment would be cut down This paper reports the experimental results of the CARS process for ... municipal wastewater treatment The technical feasibility of this process was demonstrated, and the process optimization was performed In addition, the adsorption characteristics of the activated ... increased with the decreasing temperature either for dried sludge (Zhou, 1992; Zhou and Banks, 1993) or for activated carbon (McCreary and Snoeyink, 1980) Therefore, it is hypothesized that there existed...
Ngày tải lên: 05/09/2013, 09:38
Tài liệu THE BOOK SELECTION PROCESS FOR THE BOOK CITATION INDEX IN WEB OF SCIENCE pdf
... various publishing formats THE BOOK SELECTION PROCESS BASIC PUBLISHING STANDARDS Currency of publication is a basic criterion in the evaluation process In general, books selected for both Science ... following list of book formats These are the book formats most frequently presented for coverage in the Book Citation Index • Dissertations –– Dissertations are considered for coverage if they ... bibliographic information for all cited references is essential English language full text is highly desirable, but books with full text in a language other than English are also considered for coverage...
Ngày tải lên: 21/02/2014, 21:20
Báo cáo khoa học: "A STOCHASTIC PROCESS FOR WORD FREQUENCY DISTRIBUTIONS" pot
... matrix 7) defines a uniform distribution (all pi# equal), we immediately have that the expected neighborhood density for length rnl is identical for all targets Yt, while for length m~ > rnl the ... probabilities are uniformly distributed 274 Markovian process is fittedas a front end to Simon's stochastic process, a hybrid model results that has the desired properties, since the latter process can ... Simulated Dutch m o n o m o r p h e m i c stems, as generated by a Markov process For the total distribution, N = 224567, V = 58300 For strings of length 4, N = 74618, V 6425 /, 104 35 103 #n / 28...
Ngày tải lên: 08/03/2014, 07:20
The bioliq® bioslurry gasification process for the production of biosynfuels, organic chemicals, and energy pdf
... pyrolysis gas exactly to the demand for a self-sustained process Heat required for FP Much effort has been devoted determining the specific heat required for FP The reaction enthalpy (ΔrH) of ... assumed for successive plants, down to a minimum of maybe only half of the TCI for the very first commercial plant This will be a fast process for the large number of FP plants required; for the ... Examples are: ○ For iron ore reduction, generation of either charcoal or CO or (CO + H2) mixtures via pyrolysis is a renewed old technology ○ Heat generation for high-temperature processes for cement,...
Ngày tải lên: 14/03/2014, 19:20
An Operational Process for Workforce Planning pdf
... ACQUISITION WORKFORCE PROJECTION MODEL B SAMPLE AGENDA FOR CONDUCTING THE WORKFORCE PLANNING PROCESS 49 References 59 55 FIGURES S.1 A Blueprint for Workforce Planning ... General Approach for Focusing the Data-Gathering Activity 4.1 Articulating a Business Case for Change 4.2 A Four-Step Process for Workforce Planning 4.3 An Iterative Process ... application of the structured workforce planning process described herein for its acquisition community during the summer of 2001 ix x An Operational Process for Workforce Planning business units,...
Ngày tải lên: 16/03/2014, 06:20
Quality of care A process for making strategic choices in health systems potx
... reform” Thus, the issue for policy-makers and managers is to be aware that working through this decision-making process may highlight the need for fundamental reform in their health system For ... A process for building a strategy for quality: choosing interventions An overview of the suggested process This section proposes an approach for decision-making at country level, to make informed ... priorities for quality improvement? 35 Do processes of recertification for health workers reflect priorities for quality improvement? 33 Annex A 36 Are processes of self-regulation for health workers...
Ngày tải lên: 23/03/2014, 23:21
information technology dod needs to improve process for ensuring doc
Ngày tải lên: 24/03/2014, 00:21
Báo cáo "An application of random process for controlled object identification with traffic delay problem " ppt
... L{w(t)} , U (s) = L{u(t)}; s - complex variable; L{.} ∞ g(t)e−st dt - Laplace transformation, - notation for Laplace transformation; G(s) = L{g(t)} = from any g(t) function in real domain (g(t) = 0, ... j∞)} - the real part of enough, for instance X(C, ω + j∞) Select the upper limit (ωM ) of the integral which is big enough, then trasform into approximate sum form, we obtain: 2e t x(C, t) = ... corresponding image G(s) in complex domain According to the Inverse Laplace transformation, in [6] we infered a simple formula to compute time response x(t) from its Laplace image: x(C, t) = 2πj +j∞...
Ngày tải lên: 28/03/2014, 13:20
Báo cáo " An application of random process for controlled object identification with traffic delay problem " pot
... L{w(t)} , U (s) = L{u(t)}; s - complex variable; L{.} ∞ g(t)e−st dt - Laplace transformation, - notation for Laplace transformation; G(s) = L{g(t)} = from any g(t) function in real domain (g(t) = 0, ... j∞)} - the real part of enough, for instance X(C, ω + j∞) Select the upper limit (ωM ) of the integral which is big enough, then trasform into approximate sum form, we obtain: 2e t x(C, t) = ... corresponding image G(s) in complex domain According to the Inverse Laplace transformation, in [6] we infered a simple formula to compute time response x(t) from its Laplace image: x(C, t) = 2πj +j∞...
Ngày tải lên: 28/03/2014, 13:20
Ultrafiltration process for whey
... Total: 244 cartridges of four stages Four Continuous Diafiltration Stages for Section to Reach 75 wt% TP+ NPN • CF, for every stage: CF = • flow rates • Assume W at half the feed rate F1 ⇒W= ... continuous bleed-and-feed ultrafiltration Flow Rate in Whey = Wt%*F1 Single Continuous UF Stage for Section to Reach 55 wt% TP+ NPN • Assume CF =10 • F1 =1000000 lb/ day • R1 =F1 / CF =1000000/10 ... (TP+NPN) :=0.4072 or40.72 % • P1 =F1 –R1 =1000000 – 40072=959928 lb/day =959928/8.5 = 112933 gal/day • For 20h/day , volumetric permeate rate=112933/20 =5647 gal/h J=membrane flux == 0.452 gal/ft2h Membrane...
Ngày tải lên: 26/05/2014, 10:20
the web designer's roadmap[electronic resource] your creative process for web design success
... we also maintain a list of known errata for this book you can consult for the latest updates The SitePoint Forums The SitePoint Forums1 are discussion forums where you can ask questions about ... This book is for web designers who seek a structured way to be creative when designing websites It’s ideal for designers who are just starting out, but is also useful for anyone looking for a different ... about creativity, interface design, and art Before becoming a designer, he was a fine artist for many years, which continues to inform his web design process and aesthetic In addition, Giovanni’s...
Ngày tải lên: 30/05/2014, 00:21
Sol gel process for nano technologies
... compatible for processing purposes In this case, the surface modifier should be easily removable so as not to disturb further processes As shown elsewhere, nanoparticles have been used for reinforcing ... show a perfect dispersion of the 7-nm particles The Sol-Gel Process for Nano-Technologies Figure 399 Significance of shear rates for a uniform dispersion of nanoparticles in nanocomposites Figure ... developed to be used as scratchresistant coatings for eye glass lenses [14, 20] The detailed experimental process is described elsewhere Figure regime) [21] For the preparation of the system, commercially...
Ngày tải lên: 07/06/2014, 16:27
Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt
... over-represented biological processes for the 161 upregulated genes namely, metabolic process, nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, primary metabolic process, amino acid ... frequency of genes for each biological process in each gene set was compared with the reference frequency which, in this case is the frequency of genes for that biological process in the NCBI ... system process hemopoiesis system process muscle organ development angiogenesis nervous system development ectoderm development skeletal system development developmental process immune system process...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic immortalization of human ESC-derived MSCs" doc
... over-represented biological processes for the 161 upregulated genes namely, metabolic process, nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, primary metabolic process, amino acid ... frequency of genes for each biological process in each gene set was compared with the reference frequency which, in this case is the frequency of genes for that biological process in the NCBI ... system process hemopoiesis system process muscle organ development angiogenesis nervous system development ectoderm development skeletal system development developmental process immune system process...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo toán học: " Biorefinery process for protein extraction from oriental mustard (Brassica juncea (L.) Czern.) using ethanol stillage" pdf
... to purchase water for the process and would reduce the energy costs to heat the water for protein extraction The oilseed processor would provide defatted meal as raw material for protein extraction, ... desiccator for at least h before weighing Selected samples were frozen at −20 °C and lyophilized for 48 h The effects of pH and salt on protein extraction The amount of liquid used for protein ... of California, San Francisco, CA, USA) with autocatalytic trypsin fragments as internal calibration standards All searches were performed against the National Center for Biotechnology Information...
Ngày tải lên: 20/06/2014, 20:20
báo cáo hóa học: " A scale-based forward-and-backward diffusion process for adaptive image enhancement and denoising" pdf
... subsequent processing for early vision To demonstrate the usefulness of our algorithm in an early vision task, we apply our algorithm for performing edge-enhancing filtering on medical images, for an ... diffusion process should compromise the effects of smoothing and sharpening, ensuring that the backward force can emphasize the fine structures in the image and the stabilizing forward force is ... Image Processing: Partial Differential Equations and the Calculus of Variations (Springer Verlag, New York, 2002) 38 G Gilboa, N Sochen, YY Zeevi, Forward-and-backward diffusion processes for adaptive...
Ngày tải lên: 21/06/2014, 02:20
Bạn có muốn tìm thêm với từ khóa: