... zero emission processes in food industry was investigated for soy-sauce production process as a model The detailed material flow charts in soy-sauce production process were established for TOC, T-N, ... zero-emission process of soy-sauce production, it is essential to consider how to decrease the production of cake or how to convert it to other forms so as to be accepted as an input of other processes ... Components for Analysis The material flow analysis aims to clarify the quantity and quality of input and output in each process The output from one process is the input to other processes Therefore...
Ngày tải lên: 05/09/2013, 08:40
... supplied in the form of electricity Corresponding electro-technologies not exist for the present global cement production of 2.2 Gt/a or for bricks, lime, ceramics, tiles, etc production The traditional ... pyrolysis gas exactly to the demand for a self-sustained process Heat required for FP Much effort has been devoted determining the specific heat required for FP The reaction enthalpy (ΔrH) of ... is recycled for spray quenching in the first stage, and the remainder is used for slurry preparation No hot cyclone is needed for this process version Lab- and pilot-scale bioslurry production...
Ngày tải lên: 14/03/2014, 19:20
A bacteriohodopsin ATP synthase liposome system for light driven ATP production
... develop it as a light- driven system for ATP synthesis, capable of being harnessed to power ATP-dependent enzymatic processes and devices Harnessing the relatively limitless power of sunlight and recycling ... alternate pathway for non-oxidative phosphorylation of ATP synthesis13 1.7 Artificial Transduction of Light Energy Through the photosynthetic process, Nature offers us many examples for the transduction ... proteins is a stable and long- 11 lasting platform capable of light- driven synthesis and regeneration of ATP for the use of ATP-dependent biological processes The hypothesis is based on the following...
Ngày tải lên: 15/09/2015, 22:43
THIẾT kế THỜI TRANG - CÔNG ĐOẠN KHÔ - DRY PROCESS FOR DENIM
... thời gian nhiều 30 phút VT3 Light Wash Wash sử dụng enzyme tạo bông(+đá), có thêm công đoạn tẩy mầu javel hàm lượng sử dujnng thấp 40% so trọng lương vải VT4 Super light Wash Wash sử dụng enzyme ... Nhiệt Độ Sấy % spandex % cotton Nhiệt độ sấy tối đa 99 85 98 80 97 75 Các công đoạn Processes Chà (handsanding) Mài (Grinding) cắt rách, cào xù, nhíu (cutting, scratching, tacking)...
Ngày tải lên: 14/08/2013, 09:21
ứng dụng công nghệ enzyme để thu nhận đ-ờng chức năng fructooligosaccharide (FOS) từ dịch mía Application of enzyme technology for fructooligosaccharides (FOS) production
... (2004) Handbook of food Enzymology, 805 - 822p Mazza G Edt., 1998 Functional foods: Biochemical and processing aspects.Agriculture and agrifood, Canada, woodhead publishing Ltd ...
Ngày tải lên: 29/08/2013, 08:16
Application of Ozone/UV Process for the Reclamation of Sewage Treatment Plant Effluent
... UV combination (ozone/UV) process is applied for the reuse of sewage effluent Therefore, the aim of this study is to evaluate the effectiveness of ozone/UV process for the treatment of sewage ... ozone/UV processes were significantly effective, showing 80% reduction of A410 after 10 of run time On the other hand, the UV alone process did not show much color change Therefore, for color ... calculated by dividing A254 with DOC, are compared for the ozone alone, UV alone, and ozone/UV combination processes The ozone alone process was performed at the condition of aqueous pH and to investigate...
Ngày tải lên: 05/09/2013, 08:40
IMPROVEMENT OF BIOLOGICAL SOLUBILIZATION AND MINERALIZATION PROCESS FOR FOOD WASTE
... Yaacov, 2001) Biological solubilization and mineralization process was proposed for food wastes (Okada and Nishijima, 2001) In the process, food wastes are mixed with rice hull as biological ... oxygen for the solubilization of food waste The circulating water did not contain oxygen when aeration was not carried out in the circulation tank Therefore, oxygen would be deficient for the ... mineralization process without accumulation of food wastes and to increase mineralization rate for the reduction of organic loading to the sewerage system Biological solubilization and mineralization process...
Ngày tải lên: 05/09/2013, 08:40
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH analysis and was stored at -80oC The extraction of DNA was performed with Fast ... excess sludge Figure Bench-scale continuous activated sludge process Table Influent Composition to the Bench-Scale Simulated Activated Sludge Process RUN RUN1 RUN2 RUN3 RUN4 RUN5 RUN6 RUN DATE 2002 ... was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r GTTTGCAGCGCTTTGTACCG ( Dionishi et al., 2002) were employed for the detection...
Ngày tải lên: 05/09/2013, 09:38
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater
... Therefore, the land area requirement could be significantly reduced and accordingly construction investment would be cut down This paper reports the experimental results of the CARS process for ... municipal wastewater treatment The technical feasibility of this process was demonstrated, and the process optimization was performed In addition, the adsorption characteristics of the activated ... It slightly increased as the HRT increased from h to h, but slightly decreased when the HRT increased from h to h This suggests that the h of HRT of the regeneration tank was appropriate for...
Ngày tải lên: 05/09/2013, 09:38
Different physical and chemical pretreatments of wheat straw for enhanced biobutanol production in simultaneous saccharification and fermentation
... heat [5] This process is called soaking process where, wheat straw will be soaked in sulphuric acid for few hours Saccharification will be applied after all four types of pretreatment processes During ... is applied during all three chemical pretreatment processes For example, wheat straw is mixed in dilute sulphuric acid and autoclaved at 121°C for h This study will examine acid pretreatment without ... saccharification During this soaking process, 8.0 g of wheat straw was mixed in 10 ml of sulphuric acid and 90 ml of sterilized distilled water for 3.5 h During no soaking process, the wheat straw in...
Ngày tải lên: 05/09/2013, 15:28
English On Business Practical English For International Executives_THE PRODUCTION MEETING
Ngày tải lên: 25/10/2013, 15:20
Tài liệu Báo cáo : Integrated Cultivation Technique for Microbial Lipid Production by Photosynthetic Microalgae and Locally Oleaginous Yeast pptx
... production (qP, g lipid /g cells/d) was a multiple of µ and YP/X [11, 12] D Integrated Cultivation Technique for Lipid Production Microbial lipids production via integrated technique was performed ... yeast for used as potential feedstock for biodiesel production and the capture of CO2 emissions from the yeast fermentation stage [4, 5] In conclusion, we present a cultivation technique for the ... biofuel oil and gas production processes from microalgae Energy Conversion and Management 50:1834-1840 [3] Mata, T.M., Martins, A.A., Caetano, N.S., (2010) Microalgae for biodiesel production and...
Ngày tải lên: 21/02/2014, 10:20
Tài liệu THE BOOK SELECTION PROCESS FOR THE BOOK CITATION INDEX IN WEB OF SCIENCE pdf
... various publishing formats THE BOOK SELECTION PROCESS BASIC PUBLISHING STANDARDS Currency of publication is a basic criterion in the evaluation process In general, books selected for both Science ... following list of book formats These are the book formats most frequently presented for coverage in the Book Citation Index • Dissertations –– Dissertations are considered for coverage if they ... bibliographic information for all cited references is essential English language full text is highly desirable, but books with full text in a language other than English are also considered for coverage...
Ngày tải lên: 21/02/2014, 21:20
Báo cáo khoa học: Wheat germ cell-free platform for eukaryotic protein production potx
... cell-free platform is used to screen constructs for the expression of soluble protein, to produce [15N]-labeled protein for NMR screening for suitability as a structural candidate, and for the production ... most effective routes for improve4164 ment involve a combination of bioinformatics and small scale screening Bioinformatics relies on prior information and mathematical models for correlating success ... platform Our detailed protocol for wheat germ cell-free protein production is available elsewhere [34] In short, the approach consists of four steps (Fig 1A): (1) creation of a plasmid used for...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: "A STOCHASTIC PROCESS FOR WORD FREQUENCY DISTRIBUTIONS" pot
... matrix 7) defines a uniform distribution (all pi# equal), we immediately have that the expected neighborhood density for length rnl is identical for all targets Yt, while for length m~ > rnl the ... probabilities are uniformly distributed 274 Markovian process is fittedas a front end to Simon's stochastic process, a hybrid model results that has the desired properties, since the latter process can ... in a slightly modified form, however Simon's derivation of the Yule-distribution builds on the assumption that each r grows proportionaly with N, an as- for word frequency distributions Unfortunately,...
Ngày tải lên: 08/03/2014, 07:20
REQUIREMENTS FOR PROTEIN MEALS FOR RUMINANT MEAT PRODUCTION IN DEVELOPING COUNTRIES pot
... The potential for ruminant production to be increased from poor quality forages is of the order of 5-10 fold without any increase in the demand for forage To attain such increase in production there ... staple foods The desirable developments for future food production, from a welfare viewpoint, would seem therefore to emphasise meat production to meet the demand for protein that accompanies increased ... grain Alcohol production from grain and grain availability World grain availability has been affected in the past, mostly by the demand for food for humans and feed for livestock Grain for livestock,...
Ngày tải lên: 08/03/2014, 23:20
RECOMMENDED VENTILATION STRATEGIES FOR ENERGY-EFFICIENT PRODUCTION HOMES pdf
... when the forced-air fan runs 3) Controls automatically operate the forced-air fan at regular intervals for ventilation An alternative to operating a PSC forced-air fan continually for forced-air ... and 0.50 inches w.g for supply (ducted) systems, and energy consumption of 1.00 W/cfm for HRVs, 0.60 W/cfm for spot exhaust fans, 0.50 W/cfm for PSC forced-air fans, 0.30 W/cfm for PSC ventilation ... sealed (White 1998) 11 Figure Forced-Air Supply Ventilation forced-air fan outside air duct with motorized damper forced-air ducts supply grille forced-air return forced-air fan control Ventilation...
Ngày tải lên: 09/03/2014, 00:20
ASSESSMENT OF FUEL ECONOMY TECHNOLOGIES FOR LIGHT-DUTY VEHICLES potx
... Fuel Economy Technologies for Light- Duty Vehicles SUMMARY Assessment of Fuel Economy Technologies for Light- Duty Vehicles ASSESSMENT OF FUEL ECONOMY TECHNOLOGIES FOR LIGHT- DUTY VEHICLES equal ... frame for substantive changes for a single model is approximately to years Two important technologies impacting fuel consumption are those for light- weighting and for improving transmissions Light- weighting ... Economy Technologies for Light- Duty Vehicles ASSESSMENT OF FUEL ECONOMY TECHNOLOGIES FOR LIGHT- DUTY VEHICLES other candidates for the reduction of vehicle fuel consumption, such as light- duty diesel...
Ngày tải lên: 14/03/2014, 11:20
An Operational Process for Workforce Planning pdf
... ACQUISITION WORKFORCE PROJECTION MODEL B SAMPLE AGENDA FOR CONDUCTING THE WORKFORCE PLANNING PROCESS 49 References 59 55 FIGURES S.1 A Blueprint for Workforce Planning ... General Approach for Focusing the Data-Gathering Activity 4.1 Articulating a Business Case for Change 4.2 A Four-Step Process for Workforce Planning 4.3 An Iterative Process ... application of the structured workforce planning process described herein for its acquisition community during the summer of 2001 ix x An Operational Process for Workforce Planning business units,...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: "A GRAMMAR AND A LEXICON FOR A TEXT-PRODUCTION SYSTEM" pptx
... Conse(luently, the information about the poasibilib/ of having a LOCATION constituent is not the type of information that has to be stated for specific lsxical items The information given for them concerns ... may be a word for it, in which case the concept is part of a laxical entry If there is no word for the concept, we will have to consider the various options the grammar gives us for forming an ¢oPropriate ... item, i.e of how it can be used grammatically For sold the'ctas,~ specification is the following: I will state the problem for the grammar first and then for the lexicon As verb C'/I1~ | it has been...
Ngày tải lên: 17/03/2014, 19:20