two traits may be resolved into a single trait

Combining two or more simple sentences into a single simple sentence

Combining two or more simple sentences into a single simple sentence

... The tea was too hot for me to drink Stay on top of your writing! Download our grammar guide from www.englishgrammar.org to stay up-to-date Powered by TCPDF (www.tcpdf.org)...

Ngày tải lên: 29/08/2016, 16:32

2 313 0
Tài liệu ADC’s HDSL Interface Panel combines HDSL termination, DSX-1 and DSX-3 into a single shelf doc

Tài liệu ADC’s HDSL Interface Panel combines HDSL termination, DSX-1 and DSX-3 into a single shelf doc

... splitters can be preinstalled or ordered separately ADC Fiber Distribution Hub – ACE-200 (576 Homes) Front of cabinet Rear of cabinet Base Cabinet Sizes Cabinet AFD ACE-100 ACE-200 ACE-400 Size ... specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent portfolio as an important corporate asset and vigorously enforces its patents Products ... Distribution Fiber Patch Panel Generous Labeling Area Cable Entry Point Parking-lot for Unused Splitter Ports Features Cabinet options • Almond colored, welded aluminum construction • Pole mount, pad mount,...

Ngày tải lên: 24/01/2014, 12:20

4 242 0
Attention Homeowners: You may be eligible for a Montgomery County Property Tax Credit potx

Attention Homeowners: You may be eligible for a Montgomery County Property Tax Credit potx

... programs will be reviewed by the State To get an application: • Call the Maryland State Department of Assessments and Taxation (SDAT) at 1-800-944-7403 to order an application form • Download the ... programs You can apply for all three programs with one application The tax credit programs available are: • Maryland Homeowners’ Property Tax Credit Program • Montgomery County Supplemental Property ... Maryland and Montgomery County Property Tax Reduction Programs T he State of Maryland has a program that gives a credit against the homeowner’s property tax bill if the property taxes exceed a...

Ngày tải lên: 22/03/2014, 18:20

4 251 0
Monkey with a PinWhy you may be missing 6% a year on your investment returns pot

Monkey with a PinWhy you may be missing 6% a year on your investment returns pot

... that the average gap they had calculated between theoretical returns and actual returns was –2.8% over the last 15 years This is not as high as the DALBAR figure, a difference probably explained ... monkeys at investing clearly shows that a lot of the returns we achieve are down to mere random chance But what are the main factors that drag down your alpha/skill below the apes? There are two main ... shows that equities have returned nearly 5% a year above that of the rate of inflation In contrast, holding cash has beaten inflation by only around 1% Take care with that word “cash” Normally you’d...

Ngày tải lên: 27/06/2014, 23:20

110 386 0
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx

Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx

... sequences are listed in Table Available online http://ccforum.com/content/10/5/R139 Table Locus DDAHII-449 Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC ... 0.001; Table 5) Correlation between ADMA levels and inflammatory markers Various inflammatory markers were correlated with ADMA levels on univariate analysis on both day and day (Table 6) Whereas ... patient recruitment, data and sample collection, ELISA and DNA analysis, statistical analysis, and drafting of the manuscript FD and VC participated in the ADMA analysis DK participated in the design...

Ngày tải lên: 13/08/2014, 03:20

7 266 0
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

... maintenance, and spread of malignant tumors.[30] The reduction of EGFR may lead to a failure in downstream signal cascades including PI3-K, RAS-RAF-MAPK P44/P42, and protein kinase C pathway, and ... CCTTCGCACTTCTTACACTTG -3'; probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cycler parameters included one cycle at 94°C for min, and 45 cycles involving denaturation at 94°C for 10 s annealing ... Genetic Vaccines and Therapy 2005, 3:5 Background Lung cancer is a leading cause of cancer death in Australia and the world [1,2] There are two types of lung cancers, non small cell (NSCLC) and small...

Ngày tải lên: 14/08/2014, 19:22

12 314 0
Báo cáo khoa học: The outer membrane component of the multidrug efflux pump from Pseudomonas aeruginosa may be a gated channel pptx

Báo cáo khoa học: The outer membrane component of the multidrug efflux pump from Pseudomonas aeruginosa may be a gated channel pptx

... heating at 100 °C for Lane 1, molecular mass markers: myoglobin (17 kDa), carbonic anhydrase (30 kDa), aldolase (42 kDa), albumin (66 kDa), a- galactosidase (116 kDa) and myosin (200 kDa); Lane 2, ... many gated channels have been reported and the calcium-activated potassium channel from rat adrenal chromaffin cells is one of them Solaro et al [36] have shown that the activation of this channel ... liposomes As shown in Fig 3, it was clearly demonstrated that the protease treatment caused a noticeable increase in the diffusion rates of amino acids, peptides and saccharides, and surprisingly allowed...

Ngày tải lên: 23/03/2014, 21:21

8 317 0
báo cáo hóa học:" Validity of instruments to measure physical activity may be questionable due to a lack of conceptual frameworks: a systematic review" pot

báo cáo hóa học:" Validity of instruments to measure physical activity may be questionable due to a lack of conceptual frameworks: a systematic review" pot

... instrument was based on a conceptual framework; (iii) whether the conceptual framework was defined prior to statistical analysis, defined after statistical analysis, or refined after statistical analysis; ... Functional reserve - Capacity utilization Letrait, 1996 [38] Astma Asthma Impact Record (AIR) index x x Asthma-related health status Definition not reported Gimeno-Santos et al Health and Quality ... fda.gov/downloads/Drugs/GuidanceComplianceRegulatoryInformation/ Guidances/UCM193282.pdf] American Psychological Association, American Educational Research Association, National Council on Measurement...

Ngày tải lên: 20/06/2014, 15:20

13 357 0
Chapter 105. Malignancies of Lymphoid Cells (Part 9) Two other features may be used to assess pptx

Chapter 105. Malignancies of Lymphoid Cells (Part 9) Two other features may be used to assess pptx

... primary staging, but one performed at the completion of therapy allows evaluation of persisting radiographic abnormalities, particularly the mediastinum Knowing that the PET scan or gallium scan ... gallium scan is abnormal before treatment can help in this assessment In most cases, these studies will allow assignment of anatomic stage and the development of a therapeutic plan In patients with ... reflecting major organ function; CT scans of the chest, abdomen, and pelvis; and a bone marrow biopsy Neither a positron emission tomography (PET) scan nor a gallium scan is absolutely necessary for...

Ngày tải lên: 07/07/2014, 04:20

5 351 0
Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx

Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx

... Cite this article as: Bhagawati-Prasad et al.: CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis Journal of Immune Based Therapies and Vaccines ... Chakrapani A, O’Hagan D: Nanoparticles and microparticles as vaccine-delivery systems Expert Rev Vaccines 2007, 6:797-808 Hatzifoti C, Bacon A, Marriott H, Laing P, Heath AW: Liposomal coentrapment ... protect against a particular pathogen, as well as the window of opportunity available to prevent disease We propose that CD40mAb conjugates may have utility in post-exposure prophylaxis when a rapid...

Ngày tải lên: 11/08/2014, 08:21

3 245 0
báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf

báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf

... orientation) were designed based on the sequence scaffolds of PGB02 (AATTGGTCAATTCCTAAAACACCATG, AAATTATGGGTTTTAAGGGCTAGAGTTC) and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, ... orientation) were based on the BAC scaffolds of PGB02 (3CAR) (ACCCATCTTCACAAAATTAC, GTAGTCCATAACGAGCAGAA) and PGB04 (CYP720B4) (TGATATTTGGTCTGCCATGGGCG, CATTTCCCTGCATGTATTCAATGCC, CCACCACATAGTTAGACCGTGATGC) ... to giberellin (GARE, TAACAGA; Pbox; GCCTTTTGAGT), auxin (ARF, TGTCTC; TGA-element, AACGAC; AUX28, ATTTATATAAAT), ethylene (ERE, AWTTCAAA), and abiotic stresses (HSE, AAAAAATTTC; MBS, TAACTG;...

Ngày tải lên: 12/08/2014, 03:21

13 329 0
báo cáo khoa học: " Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour" ppt

báo cáo khoa học: " Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour" ppt

... g-gliadin mRNAs (cDNAs) from wheat and the molecular characterization of comparative transcript levels of g-gliadin subclasses J Cereal Sci 2006, 43:120-128 Bartels D, Altosaar I, Harberd NP Barker ... sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in ... the database that is searched However, in the case of gamma gliadins where many proteins differ by only a few amino acids, two peptides may not be sufficient to associate a protein with a specific...

Ngày tải lên: 12/08/2014, 03:21

14 325 0
Báo cáo khoa học: "Deletions of neuraminidase and resistance to oseltamivir may be a consequence of restricted receptor specificity in recent H3N2 influenza viruses" doc

Báo cáo khoa học: "Deletions of neuraminidase and resistance to oseltamivir may be a consequence of restricted receptor specificity in recent H3N2 influenza viruses" doc

... were 5'-AATACGACTCACTATAAGCAAAAGCAGG, complementary to the 3' end of viral RNA and 5'-CGGAATTCAATACGACTCACTATAAGTAGAAACAAGG for the 5' end The PCR conditions were 94° for 20 sec, anneal at 30° ... Promoter 5' TAATACGACTCACTATAGGG complementary to the 3' end and M13 5' AACAGCTATGACCAT for the 5' end, as well as M13 5' GTTTTCCCAGTCACGAC complementary to 3' end and M13 5' CAGGAAACAGCTATGAC for ... sialylated glycan on the array (bottom panel) The array keys and data are available on the CFG web site [32] The results are summarized in Table sugars (Figure and Table 3) There was no correlation...

Ngày tải lên: 12/08/2014, 04:21

15 281 0
Báo cáo khoa học: "Elimination of Mange Mites Sarcoptes scabiei var. suis from Two Naturally Infested Danish Sow Herds Using a Single Injection Regime with Doramectin" pdf

Báo cáo khoa học: "Elimination of Mange Mites Sarcoptes scabiei var. suis from Two Naturally Infested Danish Sow Herds Using a Single Injection Regime with Doramectin" pdf

... body Animals were restrained, and the area was scraped with a sharp spoon until blood was visible The material obtained from the scraped area was transferred into a Vacutainer® glass tube labelled ... emphasizes that thorough precautions and preparations should always be an integral part of a mange elimination program Under-dosing or missing one single animal could lead to failure, if the goal ... days of age Housing: Gestation and mating areas, as well as farrowing pens, had slatted flooring Pregnant sows were kept in stalls Pigs were weaned into a climate-controlled 2-stage weaning accommodation,...

Ngày tải lên: 12/08/2014, 15:20

10 260 0
Báo cáo y học: "Noninvasive mechanical ventilation may be useful in treating patients who fail weaning from invasive mechanical ventilation: a randomized clinical trial" pps

Báo cáo y học: "Noninvasive mechanical ventilation may be useful in treating patients who fail weaning from invasive mechanical ventilation: a randomized clinical trial" pps

... IMV by analyzing cardiac and respiratory parameters, clinical course, and complications Page of (page number not for citation purposes) Materials and methods Population and sample A randomized ... 142:523-528 35 Fagon JY, Chastre J, Hance AJ, Montravers P, Novara A, Gilbert C: Nosocomial pneumonia in ventilated patients: a cohort study evaluating attributable mortality and hospital stay Am J Med ... controlled trial Am J Respir Crit Care Med 2003, 168:70-76 Burns KEA, Adhikari NKJ, Meade MO: A meta-analysis of noninvasive weaning to facilitate liberation from mechanical ventilation Can J Anesth...

Ngày tải lên: 13/08/2014, 10:20

8 233 0
ĐỒ án cấu TRÚC máy TÍNH LAB3 DESIGN a MIPS 32  BIT SINGLE   CYCLE CPU

ĐỒ án cấu TRÚC máy TÍNH LAB3 DESIGN a MIPS 32 BIT SINGLE CYCLE CPU

... (writeenable) begin datamem[address]=writedata[31:24]; datamem[address+1]=writedata[23:16]; datamem[address+2]=writedata[15:8]; datamem[address+3]=writedata[7:0]; end always @(address or datamem[address] ... or datamem[address+1] or datamem[address+2] or datamem[address+3]) begin temp={datamem[address],datamem[address+1],datamem[address+2],datamem[address+3]}; end initial begin $writememb("data.txt", ... buf25(readdata[25],temp[25]), buf10(readdata[10],temp[10]), buf26(readdata[26],temp[26]), buf11(readdata[11],temp[11]), buf27(readdata[27],temp[27]), buf12(readdata[12],temp[12]), buf28(readdata[28],temp[28]),...

Ngày tải lên: 21/07/2015, 15:37

27 578 4
ĐỒ ÁN CẤU TRÚC MÁY TÍNH LAB 3 A MIPS 32-BIT SINGLE - CYCLE CPU

ĐỒ ÁN CẤU TRÚC MÁY TÍNH LAB 3 A MIPS 32-BIT SINGLE - CYCLE CPU

... MÁY TÍNH Nhóm 28 Bổ sung Datapath PC = PC + ĐỒ ÁN CẤU TRÚC MÁY TÍNH Nhóm 28 Bổ sung Datapath Lệnh BNE (Brand if not equal) ĐỒ ÁN CẤU TRÚC MÁY TÍNH Nhóm 28 Bổ sung Datapath Lệnh JUMP ĐỒ ÁN CẤU TRÚC ... TÍNH Nhóm 28 Bổ sung Datapath Lệnh loại I: Lấy liệu từ ghi Rs RegFile Mở rộng dấu cho 16bit immediate Đ a vào khối tính toán ALU Kết tính toán đ a ghi Rd RegFile làm đ a truy cập vào nhớ liệu ... TÍNH Nhóm 28 Bổ sung Datapath ĐỒ ÁN CẤU TRÚC MÁY TÍNH Nhóm 28 Bổ sung Datapath Lệnh nhảy: • Nhảy có điều kiện: BNE • Nhảy không điều kiện: J, JR Bổ sung: Các Mux chọn đ a cho lệnh Các cộng...

Ngày tải lên: 09/08/2015, 14:40

29 1,2K 2
w