treatment of a patient with implant supported fixed complete denture prostheses

Báo cáo y học: "Comparison between single antiplatelet therapy and combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with antiphospholipid syndrome"

Báo cáo y học: "Comparison between single antiplatelet therapy and combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with antiphospholipid syndrome"

... was 3.9±2.0 years The cumulative incidence of stroke in patients with single antiplatelet treatment was higher than that in patients receiving the combination of antiplatelet and anticoagulation ... secondary prevention of stroke with APS, and compared single antiplatelet therapy and a combination of antiplatelet and anticoagulation therapy in ischemic stroke patients with APS The subjects were ... 2010, with APS We therefore compared single antiplatelet therapy and a combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with APS According...

Ngày tải lên: 26/10/2012, 09:48

4 601 0
Removal of arsenic from synthetic groundwater by adsorption using the combination of laterite and ironmodified activated carbon

Removal of arsenic from synthetic groundwater by adsorption using the combination of laterite and ironmodified activated carbon

... 135 (*Wako Pure Chemicals Ltd, Japan) Preparation of Adsorbents Preparation of LA In this study, laterite was collected from Ogasawa Island (Tokyo, Japan) It was sieved to a particle size of 0.45-0.71mm ... silica with positive surface charge under normal conditions Therefore, LA can adsorb anionic contaminants as As[III] and As[V] (Larsson et al., 1999) A number of researchers (Larsson et al., ... carbon (AC) is always considered as a typical adsorbent, but AC has low arsenic removal capacity The percentage removal of As[III] by AC is just 50% (Prasenjit et al., 2007) However, it can be...

Ngày tải lên: 05/09/2013, 09:38

12 530 0
Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

... grammatical analysis of Portuguese in a constraint grammar framework 2nd International Conference on Language Resources and Evaluation, Athens, Greece TELRI J P Chanod and P Tapanainen 1995 Tagging ... Morphological tagging: Data vs dicc tionaries In Proceedings of the NAACL’00, Seattle, WA, pages 94–101 ACL Jan Hajiˇ and Barbora Hladk´ 1997 Tagging of inc a flective languages: a comparison In Proceedings ... stochastic and rulebased methods for disambiguation in agglutinative languages In Proceedings of ACL/COLING’98, Montreal, Canada, pages 379–384 ACL/ICCL Jan Hajiˇ 1998 Building a syntactically anc...

Ngày tải lên: 08/03/2014, 05:20

8 519 0
Synergistic combination of heat and ultrasonic waves under pressure for cronobacter sakazakii inactivation in apple juice

Synergistic combination of heat and ultrasonic waves under pressure for cronobacter sakazakii inactivation in apple juice

... a heat treatment at 56  C for inactivating 90% of the C sakazakii population, the same level of inactivation can be achieved after 0.28 of MTS treatments at the same temperature Therefore, a ... Similarly, a certain proportion of C sakazakii cells also were sublethally damaged in their cytoplasmic and outer membranes after a heat treatment at the same temperature (Fig 3B) A 1.7-fold and a ... the survival of a strain of Staphylococcus aureus Journal of Dairy Research, 54, 61e67 Pagán, R., Mañas, P., Palop, A. , & Sala, F J (1999) Resistance of heat-shocked cells of Listeria monocytogenes...

Ngày tải lên: 05/05/2014, 08:43

7 481 0
Báo cáo hóa học: " First-line chemoimmunotherapy in metastatic breast carcinoma: combination of paclitaxel and IMP321 (LAG-3Ig) enhances immune responses and antitumor activity" pptx

Báo cáo hóa học: " First-line chemoimmunotherapy in metastatic breast carcinoma: combination of paclitaxel and IMP321 (LAG-3Ig) enhances immune responses and antitumor activity" pptx

... chemotherapy and immunotherapy can form a practical partnership in the treatment of cancer Additional material Additional file 1: Anti-IMP321 antibodies Sera collected at baseline and weeks after ... compared to the baseline at D1 was calculated The number of markers (n) displaying an increase by at least 50% was calculated for each patient in the 1.25 mg (7 patients) and 6.25 mg (12 patients) ... mix of HRPconjugated goat anti-human kappa and goat anti-human lambda antibodies (Serotec) As controls, various concentrations of a recombinant human monoclonal antibody fragment Fab-dHLX-MH directed...

Ngày tải lên: 18/06/2014, 16:20

11 472 0
Báo cáo sinh học: "Combination of cyclosporine and erythropoietin improves brain infarct size and neurological function in rats after ischemic stroke" potx

Báo cáo sinh học: "Combination of cyclosporine and erythropoietin improves brain infarct size and neurological function in rats after ischemic stroke" potx

... signals were digitized using Labwork software (UVP) On each gel, a standard control sample was loaded Statistical Analysis Data were expressed as mean values (mean ± SD) Statistical analysis was ... stress analyses Measurement of Brain Infarct Area To evaluate the impact of CsA, EPO, and combined EPO and CsA treatment on brain infarction, coronal Yuen et al Journal of Translational Medicine 2011, ... were placed on a tray with a scaled vertical bar to which a digital camera was attached The sections were photographed from directly above at a fixed height The images obtained were then analyzed...

Ngày tải lên: 18/06/2014, 22:20

14 475 0
Báo cáo hóa học: " A combination of hard and soft templating for the fabrication of silica hollow microcoils with nanostructured walls" pptx

Báo cáo hóa học: " A combination of hard and soft templating for the fabrication of silica hollow microcoils with nanostructured walls" pptx

... Universidad de Santiago de Compostela, Santiago de Compostela, 15782, Spain 5Toyota Physical & Chemical Research Institute, Nagakute, Aichi, 4801192, Japan Additional material Additional file ... of PDI dye, and Prof Po-Da Hong and Prof Shawn D Lin (National Taiwan University of Science and Technology) for experimental support Author details International Iberian Nanotechnology Laboratory ... Spain 3Graduate Institute of Engineering, National Taiwan University of Science and Technology, 43 Keelung Road, Section 4, Taipei, Taiwan 4Departamento de Química Física, Facultad de Química,...

Ngày tải lên: 21/06/2014, 04:20

7 525 0
Báo cáo khoa học: "The combination of deoxynivalenol and zearalenone at permitted feed concentrations causes serious physiological effects in young pigs" ppt

Báo cáo khoa học: "The combination of deoxynivalenol and zearalenone at permitted feed concentrations causes serious physiological effects in young pigs" ppt

... AATTCCGGTAGATAATCT Primer-R: TGATGAGTTCACTGATGGCTTTG X53085 TNF-α Primer-F:GATCATCGTCTCAAACCTCAGATAAG MGB Probe: TGTAGCCAATGTCAAAGC Primer-R: GGCATTGGCATACCCACTCT M29079 X54859 β-actin Primer-F: CGACGGGCAGGTCATCAC ... g/l Albumin/Globulin γ-Glutamyltransferase, U/l Alanine aminotransferase, U/l Aspartate aminotransferase, U/l Aspartate aminotransferase/Alanine aminotransferase Control Toxin 69.15 ± 0.6 0a* a ... determination of total protein, albumin, globulin, γ-glutamyltransferase (GGT), aspartate aminotransferase (AST), and alanine aminotransferase (ALT) by automatic clinical chemistry analyzer (CobusMira-Plus;...

Ngày tải lên: 07/08/2014, 20:23

6 180 0
Báo cáo y học: "Inhibitory effects on HAV IRES-mediated translation and replication by a combination of amantadine and interferon-alpha" doc

Báo cáo y học: "Inhibitory effects on HAV IRES-mediated translation and replication by a combination of amantadine and interferon-alpha" doc

... combination of amantadine and IFN-alpha against HAV replication were stronger than those by amantadine or IFN-alpha monotreatment IFN-alpha was more effective than amantadine against the HAV replicon ... demonstrating that a combination of amantadine and IFN-alpha can suppress HAV replication more effectively than amantadine or IFN-alpha alone Abbreviations HAV: hepatitis A virus; IRES: internal ribosomal ... we evaluated the HAV antiviral activity of amantadine and IFN-alpha We initially examined the effects of this combination on HAV IRES-mediated translation using a luciferase reporter assay Huh7...

Ngày tải lên: 12/08/2014, 01:21

5 301 0
Báo cáo thú y: "The effect of the combination of acids and tannin in diet on the performance and selected biochemical, haematological and antioxidant enzyme parameters in grower pig" docx

Báo cáo thú y: "The effect of the combination of acids and tannin in diet on the performance and selected biochemical, haematological and antioxidant enzyme parameters in grower pig" docx

... Switzerland) Haematological analyses CBC was determined immediately after collection with an automated haematological analyser (ABC Vet, Horiba ABX, Montpellier, France) WCDC was determined manually on ... Guerra N, Fajardo Bernardez P, Mendez J, Cachaldora P, Pastrana Castro L: Production of four potentially probiotic lactic acid bacteria and their evaluation as feed additives for weaned piglets Anim ... twice, at the beginning and end of the feeding trial Blood was collected from the vena cava cranialis, for determination of biochemical profile and haematological and antioxidant enzyme parameters...

Ngày tải lên: 12/08/2014, 18:22

8 469 0
Báo cáo y học: "Combination of histopathological and electromyographic patterns can help to evaluate functional outcome of critical ill patients with neuromuscular weakness syndromes" docx

Báo cáo y học: "Combination of histopathological and electromyographic patterns can help to evaluate functional outcome of critical ill patients with neuromuscular weakness syndromes" docx

... be another measure of severity of sepsis and multiple organ failure Steroid administration appears to be associated with muscular lesions, regardless of association with neuropathy All study patients ... the end of prolonged sedation associated with mechanical ventilation (>15 days after the onset of mechanical ventilation) Failure to wean from mechanical ventilation was characterized by inability ... were available in all 15 patients The endpoints were death or time to ambulation without assistance The maximal duration of follow up was 12 months Findings were not analyzed statistically because...

Ngày tải lên: 12/08/2014, 20:20

9 427 0
A Novel Combination of Negative and Positive Selection in Artificial Immune Systems

A Novel Combination of Negative and Positive Selection in Artificial Immune Systems

... created by PNSA on Netflow dataset The final experiment is on Spambase dataset [23], that consists of 4601 instances of ham and spam e-mail messages with 39.4% being spam We use 2509 (90%) ham emails ... on data where adjacent regions of the input data sequence are not necessarily semantically correlated, such as in network data packets [18] We denote Σ = {0, 1} as the alphabet for detectors and ... incoming data instance matches any detector, it is claimed as non-self or anomaly Begin Begin Generate Random Candidates Input new samples Yes Match self samples? Match any detector? No No Accept as...

Ngày tải lên: 13/08/2015, 10:00

10 353 0
Tài liệu LoopStar® 711 Leveraging a Full Suite of Ethernet and TDM Services to Cost-Effectively Utilize Fiber Networks doc

Tài liệu LoopStar® 711 Leveraging a Full Suite of Ethernet and TDM Services to Cost-Effectively Utilize Fiber Networks doc

... *Includes: AC power supply and AC power cord, blanking plate, 19” and 23” rack mount brackets, console cable, license for basic software and documentation LPS-711-48DC L1 SPEC SHEET LPS-711-48VDC Package ... specifications without prior notice At any time, you may verify product specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent portfolio as an ... 19” and 23” rack mount brackets, console cable, license for basic software and documentation LPS-711-AC L1 Web Site: www.adc.com From North America, Call Toll Free: 1-800-366-3891 • Outside of...

Ngày tải lên: 10/12/2013, 19:15

4 406 0
Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

... Discriminative reranking for natural language parsing Computational Linguistics, 31(1):25–69 Kiyoaki Shirai, Kentaro Inui, Takenobu Tokunaga, and Hozumi Tanaka 1998 An empirical evaluation on statistical ... structure analyzer In Proceedings of the Workshop on Sharable Natural Language Resources, pages 48–55 Sadao Kurohashi and Makoto Nagao 199 8a Building a Japanese parsed corpus while improving the parsing ... Proceedings of the 1st International Conference on Language Resources and Evaluation, pages 719–724 Sadao Kurohashi and Makoto Nagao 1998b Japanese Morphological Analysis System JUMAN version 3.5 Department...

Ngày tải lên: 20/02/2014, 12:20

8 482 0
Tài liệu Higher economic growth through macroeconomic policy coordination? The combination of wage policy and monetary policy docx

Tài liệu Higher economic growth through macroeconomic policy coordination? The combination of wage policy and monetary policy docx

... estimated parameters are based on empirical data, the NiGEM model The advantage of this model’s realistic nature comes with the disadvantage of having less transparency and that results are strongly ... the analytical apparatus has been changed Instead of using a small theoretical model, we will investigate the effects of coordinating wage and monetary policies as part of a detailed macroeconometric ... obey a certain target path for wages in the euro area as a whole It has to be recognized that wage increases in the euro area trace back to different national wage developments that can be centrally...

Ngày tải lên: 20/02/2014, 20:20

31 505 0
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx

A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx

... way in which people can access and make use of their assets Natural capital Natural capital is the quality and quantity of natural resources that are available to people and above all, the access ... provides a basis for kinship support Financial capital correlates often with Box A4 : Livelihoods assets pentagon Natural capital Social capital Physical capital Financial capital Human capital 41 ... quantitative data Aside from common database and statistical computer programmes such as Access, SPSS and SAS, spreadsheet programmes can also be useful, particularly if databases are relatively small and...

Ngày tải lên: 07/03/2014, 00:20

95 646 0
Báo cáo khoa học: "Transparent combination of rule-based and data-driven approaches in a speech understanding architecture" pot

Báo cáo khoa học: "Transparent combination of rule-based and data-driven approaches in a speech understanding architecture" pot

... level, semantic interpretation is viewed as a statistical classification task An interpretation consists of a set of one or more semantic atoms Each utterance is associated with a set of features; ... reliable, giving a stronger association with decrease_volume and a correct interpretation In effect, the hand-coded rules act as a kind of backing-off mechanism, alleviating the problem of data ... concludes Semantic analysis as classification This section describes an abstract architecture which characterises semantic analysis as a task slightly extending the "decision-list" classification algorithm...

Ngày tải lên: 08/03/2014, 21:20

8 461 0
Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx

Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx

... isolated DNA was extracted with phenol and chloroform, precipitated with ethanol and Na-acetate, and resuspended into water Total cellular DNA was also alternatively isolated with QIAamp DNA Blood ... Nishizawa T, Kato N, Ukita M, Ikeda H, Iizuka H, Miyakawa Y & Mayumi M (1998) Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion hepatitis of unknown ... Miyata H, Tsunoda H, Kazi A, Yamada A, Khan MA, Murakami J, Kamahora T, Shiraki K & Hino S (1999) Identification of a novel GC-rich 113-nucleotide region to complete the circular, single-stranded...

Ngày tải lên: 16/03/2014, 05:20

12 446 0
w