... compensation The mai-baap manager The Indian manager has a unique role to play, that of mai-baap (mother-father, that is, parents) Many team members also expect the manager to play almost a parental role ... managing is in the knowledge industry, how to deal with the transition from an individual contributor to a manager, and how to understand the behaviors that make a successful and respected manager ... Coordinator Vishal Bodwani Proofreader Aaron Nash Kishore Shenoi Pankaj Ghanshani Indexer Tejal Daruwale Acquisition Editors Amey Kanse Kartikey Pandey Lead Technical Editor Kartikey Pandey Technical...
Ngày tải lên: 23/03/2014, 13:20
... dye-labeled somatostatin analogs accumulating in certain cancer cells are used with the diagnostic method SRS, and conjugates of stable somatostatin analogs with toxic compounds or radioisotopes ... Roosterman et al bypasses degradation, accumulates in the cell and is released as intact ligand from the cells in the surrounding medium Intracellular degradation of somatostatin A SSTR3-mediated ... N-terminal a- amino function The rhodamine-B was activated using ByBop (Novabiochem, Darmstadt, Germany) and N-methylmorpholine as a base Rhodamine-B was added in a four-fold surplus to the a- amino...
Ngày tải lên: 16/03/2014, 06:20
Making the transition from s7 200 to s7 1200
... your actual hardware set Hardware modules are selected from a hardware catalog tree and dragged into a rack image HMI After your system hardware image is assembled, use a mouse click on an ... battery cartridge, or programmed writes to a flash memory cartridge to retain memory data Page 13/48 S7-1200 Transition Manual A5 E02486860-01 S7-1200 Transition Manual A5 E02486860-01 © Siemens AG 11/2009 ... Symbolic access is available to all elements of an Array or DTL structure Page 42/48 S7-1200 Transition Manual A5 E02486860-01 S7-1200 Transition Manual A5 E02486860-01 © Siemens AG 11/2009 All Rights...
Ngày tải lên: 24/05/2014, 21:49
Báo cáo y học: "Prehospital therapeutic hypothermia after cardiac arrest - from current concepts to a future standard" pot
... also need to take into account relevant patient characteristics (e.g initial cardiac rhythm), delays, Page of (page number not for citation purposes) Scandinavian Journal of Trauma, Resuscitation ... Scandinavian Society of Anaesthesiology and Intensive care Medicine: Scandinavian Clinical practice guidelines for therapeutic hypothermia and post-resuscitation care after cardiac arrest Acta ... Prehospital therapeutic hypothermia for comatose survivors of cardiac arrest: a randomized controlled trial Acta Anaesthesiol Scand 2009, 53:900-7 Hammer L, Vitrat F, Savary D, Debaty G, Santre...
Ngày tải lên: 13/08/2014, 23:21
Tài liệu COMMUNICATION FROM THE COMMISSION TO THE COUNCIL AND THE EUROPEAN PARLIAMENT Innovation in a knowledge-driven economy ppt
... which innovation is seen as arising from complex interactions between many individuals, organisations and environmental factors, rather than as a linear trajectory from new knowledge to new product ... deficit In particular, the relevance of the regulatory, administrative and financial environment to innovation has often been underestimated Today, awareness is more general and good practices are beginning ... should act as a catalyst and contribute to enhancing the activities of Member States The targets are to: – Examine and benchmark innovation policies and performances of Member States, and compare...
Ngày tải lên: 16/01/2014, 16:33
Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt
... Private Sub Page_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load 'Put user code to initialize the page here Dim odaProdIndiv As OleDb.OleDbDataAdapter odaProdIndiv ... page Listing 5.30 wfrmHowTo5_ 8a. aspx.vb: Filling and Binding the Products to the DataGrid Object Private Sub Page_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load ... Open and run the Visual Basic NET-Chapter solution From the main page, click on the hyperlink with the caption How -To 5.8: Hyperlink From a Row in the Data Grid to a Detail Page You then see all...
Ngày tải lên: 21/01/2014, 12:20
11 lessons from microsofts initiative to create a sustainable service culture
... They and their managers need to be committed, rewarded and recognized People want to great work, they want to know they make an impact that is measurable and appreciated Find advocat es or champions ... are times when speed is more important than quality, for example And the reverse can be true, even for the same person on the same day Simply said, to create value, you need to understand what ... each team is dependent on others to deliver a great experience It also allows you to be intentional about the experience you want to deliver It is easy to focus on what you specifically own, and...
Ngày tải lên: 27/01/2014, 11:07
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt
... molecules and peptide atoms) and rj is the standard deviation of B factors The normalized B factors have a zero mean and unit variance All atoms that satisfy Bz ‡ are treated as outliers and discarded ... cargo The average atomic B factors for importin -a in the structure are ˚ ˚ 32.1 A2 for main-chain atoms, 35.7 A2 for side-chain ˚ overall (3244 atoms) For the pepatoms and 33.8 A tide, B factors ... are slightly higher than those for ˚ ˚ importin -a: 36.9 A2 for main-chain atoms, 40.2 A2 for ˚ overall (62 total atoms) side-chain atoms and 38.7 A Electron density analysis Both the main-chain...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Preparedness and Response to a Mass Casualty Event Resulting from Terrorist Use of Explosives pdf
... seen after natural disasters Because many patients self-evacuate after a terrorist attack, prehospital care may be difficult to coordinate and hospitals near the scene can expect to receive a large ... develop a planning framework (surge capacity and capability map) that presents all available and relevant internal and external resources This framework should be transparent, updated, and shared ... hospitals will face in a mass casualty event (MCE) include surge capacity and capability issues in emergency and trauma services, as well as medical, paramedical, administrative, logistical, and...
Ngày tải lên: 19/02/2014, 03:20
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... obtained from the Japan Snake Institute, Gunma, Japan Phenyl Sepharose CL-4B, DEAE Sepharose CL-6B and Superdex 75 were purchased from Amersham Pharmacia Biotech; Concanavalin A (Con A) agarose ... Yasuda, T., Sawazaki, K., Nadano, D., Takeshita, H., Nakanaga, M & Kishi, K (1993) Human seminal deoxyribonuclease I (DNase I): purification, enzymological and immunological characterization and ... respect to their structural relationships, snake DNases I are far from amphibian enzymes, but close to mammalian and avian DNases I Thermal stabilities of wild-type and substitution mutant snake DNases...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu From Crow-Scaring to Westminster; an A doc
... Applegate was the contractor and foreman on this yard, on which was manufactured all kinds of ware My foreman was quite a skilled tradesman and he took great interest in me and set me to manufacture ... had another trade at my back, namely brickmaking There was a great call for brickmakers at this time and I obtained work at once with James Applegate at Blickling, himself a leader of the Amalgamated ... victimization pay Legal advice to be given Each member to pay 1s per year harvest levy to enable a member to have his harvest money made up to him in case of a dispute Each member to pay a contribution...
Ngày tải lên: 21/02/2014, 11:20
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT GTACTTGCGCTCAGGAGGAG 178 246 173 138 83 259 92 128 109 114 107 312 Glen Brunie, MA, USA)...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Assignment of the [4Fe-4S] clusters of Ech hydrogenase from Methanosarcina barkeri to individual subunits via the characterization of site-directed mutants pdf
... chromosomal DNA using primers 5¢-GGCGCGCCGGGCCC ACGGAGTAGTGGCAGCACTT-3¢ and 5¢-GGCGCGCC CTCGAGGGAGAACATTCAGTATTGTTTTTCAAG-3¢ (restriction sites are underlined), digested with ApaI and XhoI, and ligated ... mm) was added to high-salt media as carbon and energy source Puromycin was added to mgÆmL)1 as appropriate Preparation of cell extracts and isolation of Ech hydrogenase Ech hydrogenase was purified ... Metcalf WW (2002) Genetic analysis of the archaeon Methanosarcina barkeri Fusaro reveals a central role for Ech hydrogenase and ferredoxin in methanogenesis and carbon fixation Proc Natl Acad Sci...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot
... (such as the vocalic nucleus of a syllable) Where it appears natural to so, units on certain phonological tiers are also linked to right domain edges (ms is the case with phrase and boundary tone ... collapsed representation economical and relatively transparent We note in passing that although collapsing multilinear data-structures onto a single tier increases the likeliness of combinatorial ... between intonational phra~ses (IP), are inserted by the generator in between words and these T and B are then mapped to GToBI labels (German Tones and Break Indices- (Grice et al 96)) or discarded...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: "From route descriptions to sketches: a model for a text-to-image translator" doc
... A. I Technical report 540, M.I.T Artificial Intelligence Laboratory, Cambridge, MA A Yamada, T Yamamoto, H Ikeda, T Nishida, and S Doshita 1992 Reconstructing spatial image from natural language ... made up of transfers and relays Relays are abstract points initiating transfers and may be "covered" by a turn Landmarks can be either associated with relays or with transfers More formally, a ... (landmarks), or a turn and a landmark, mentioned in the text immediately one after •the other Concerning the ambiguity related to the location of landmarks, one can either choose an arbitrary...
Ngày tải lên: 08/03/2014, 07:20
A MANAGER’S GUIDE TO COACHING pdf
... quantities of AMACOM books are available to corporations, professional associations, and other organizations For details, contact Special Sales Department, AMACOM, a division of American Management ... their years, Brian and Anne offer counsel that is both wise and practical to individuals at all levels of an organization.” —David Coleman, President, Transitional Management Services “The manager s ... Praise for A Manager s Guide to Coaching “This book does a great job of examining an area of leadership often overlooked by new (and seasoned) managers Practical, and easy to read, it lays...
Ngày tải lên: 08/03/2014, 16:20
ORGANIZATIONS DON’T TWEET, PEOPLE DO - A Manager’s Guide to the Social Web
... politician or someone in a corporate setting to really be authentic But I am hopeful There are enough examples already where people have managed to tread that line Managed to be real, to have a personality, ... too easy to dismiss what is happening as technological – to label it “digital” – and to miss the real point – the changes we are seeing are cultural Cultural changes that were happening anyway ... form that takes Now here is a radical idea As democracy faces the twin challenges of younger generations apparently disengaging from the electoral process and large corporations having a global influence...
Ngày tải lên: 15/03/2014, 15:20
A Manager’s Guide to Leadership An action learning approach 2nd edition
... for an organisation? We have learned that organisational design is no science There are too many variables and dilemmas for any rational solution A strong design brings clarity and can make organisational ... domain means that leadership is always situated: always done here, in a specific location, with particular people In this way, acts of leadership are always local and what works here and now, may ... this company we have declared that we are going to be a learning organisation Not only this but that we are going to be a world class learning organisation! We have a “learning table” at lunchtimes...
Ngày tải lên: 17/03/2014, 21:29