... and, in small amounts, terminal-Rha and 6-substituted-Glc In addition, the disaccharide 7-O-carbamoyl-Hep-(1fi3)Hep was found Fatty acid analysis revealed the presence of typical fatty acids of ... structural characterization NMR spectroscopy and MALDI-TOF MS spectrometry of oligosaccharide Oligosaccharide was isolated by gel permeation chromatography after complete deacylation of the LOS of ... Negative ion MALDI-TOF mass spectra of oligosaccharide obtained in linear mode at normal (A) and higher laser intensity (B) Assignments of main ion peaks are shown P, phosphate; Pyr, pyruvic acid...
Ngày tải lên: 19/02/2014, 13:20
... experiments Statistical significance of results between lipid systems was analysed using oneway ANOVA software (GraphPad software, San Diego, CA, USA) Ó FEBS 2002 Membrane- reconstituted human CYP 1A1 (Eur ... now generally assumed that microsomal P450s apart from their N-terminal transmembrane domain have additional attachment region(s) associating the protein partially buried into the membrane [35] ... phosphatidic acid in a weight ratio of : : 0.06 Rates represent Vmax values determined by kinetic analysis based on data from three separate experiments Ratios were calculated from these Vmax values...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc
... mutagenesis using HA-RPTPa WT as the template and the following forward and reverse oligonucleotides: 5¢- ATG AAG AAG AAC CAT GTT TTA CAG ATC -3¢ and 5¢ - GAT CTG TAA AAC ATG GTT CTT CTT CAT - 3¢ The ... kinase assay, using enolase as a substrate, and the amount of incorporated phosphate was visualized by autoradiography (top panel) The positions of enolase and Src are indicated The other half of ... distinctive form of Noonan syndrome Nat Genet 39, 75–79 37 Razzaque MA, Nishizawa T, Komoike Y, Yagi H, Furutani M, Amo R, Kamisago M, Momma K, Katayama H, Nakagawa M et al (2007) Germline gain -of- function...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo Y học: A functional role of the membrane-proximal extracellular domains of the signal transducer gp130 in heterodimerization with the leukemia inhibitory factor receptor pot
... C46 6A( sense) 5¢-GATAAA GCACCCGCTATCACAGACTGG-3¢; C46 6A( antisense) 5¢-CCAGTCTGTGATAGCGGGTGCTTTATCTG-3¢; C49 1A( sense) 5¢-GCAGAGAGCAAAGCCTATTTGAT AACAG-3¢ and C491(antisense) 5¢-TGTTATCAAATAG GCTTTGCTCTCTG-3¢ ... AGACTGGACACATGG-3¢ and 5¢-TCGGGCCATGGC ATGCCCGGGGGTCAGAGCTGGG-3¢ for amplification of D4 of GCSFR and 5¢-TACTCTCAAGAAATG CCCGGGTCCCATGCCCCAGAG-3¢ and 5¢-GCCCAG GATGATGTGTAGCTCCCCGGGCTCTGGGGTCAA GGT-3¢ for D6 of ... PCR reactions were: pSVL(sense) 5¢-GTGTTACTT CTGCTCT-3¢; pSVL(antisense) 5¢-TCTAGTTGTGGTT TGT-3¢; C45 8A( sense) 5¢-ATACTTGAGTGGGCTGTG TTATCAG-3¢; C45 8A( antisense) 5¢-ATCTGATAACAC AGCCCACTCAAGTAT-3¢;...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf
... subunits, disassembly of transmembrane a helices, and a separation in the contact surface of membrane and protein due to the thickening and shrinkage of lipid bilayer For the last case, a quantitative ... 40 Tsuda, T., Kaya, S., Yokoyama, T., Hayashi, Y & Taniguchi, K (1998) ATP and acetyl phosphate induces molecular events near the ATP binding site and the membrane domain of Na+, K+-ATPase: The ... concentration of Na+ activates pyruvate kinase without K+ [27] The reaction was initiated by an addition of lg enzyme K+-activated phosphatase activity was determined as K+-dependent pNPPase activity...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo toán học: " Synthesis of highly transparent ultrananocrystalline diamond films from a lowpressure, low-temperature focused microwave plasma jet" ppt
... Engineering and Institute of Manufacturing Technology, National Taipei University of Technology, Taipei, 106, Taiwan Graduate Institute of Mechanical and Electrical Engineering, National Taipei University ... Digital Instruments, Santa Barbara, CA, USA) for obtaining comprehensive information on the surface morphology, roughness, atomic bonding nature, and detailed nanostructural characterizations ... vivo evaluation of ultrananocrystalline diamond for coating of implantable retinal microchips J Biomed Mater Res B 2006, 77:273-281 Ferrari AC, Robertson J: Interpretation of Raman spectra of disordered...
Ngày tải lên: 20/06/2014, 20:20
Báo cáo hóa học: " A Novel Self-aligned and Maskless Process for Formation of Highly Uniform Arrays of Nanoholes and Nanopillars" pot
... produced a large area of highly uniform hexagonally packed gold nanoposts and nanoholes in gold thin film 123 using the uniform HCP nanoholes and nanopillars of photoresist for lift-off process, as ... 5a and b These metal nanoposts and nanoholes can be potentially applied into photonic crystals, and also for further processing using as metal masks Conclusions We have demonstrated a novel maskless ... fabrication process for periodic particle array surfaces J Vac Sci Technol A 13, 1553–1558 (1995) Z Chen, A Taflove, V Backman, Photonic nanojet enhancement of backscattering of light by nanoparticles:...
Ngày tải lên: 21/06/2014, 22:20
Báo cáo hóa học: " Synthesis of highly transparent ultrananocrystalline diamond films from a lowpressure, low-temperature focused microwave plasma jet" docx
... Engineering and Institute of Manufacturing Technology, National Taipei University of Technology, Taipei, 106, Taiwan Graduate Institute of Mechanical and Electrical Engineering, National Taipei University ... Digital Instruments, Santa Barbara, CA, USA) for obtaining comprehensive information on the surface morphology, roughness, atomic bonding nature, and detailed nanostructural characterizations ... vivo evaluation of ultrananocrystalline diamond for coating of implantable retinal microchips J Biomed Mater Res B 2006, 77:273-281 Ferrari AC, Robertson J: Interpretation of Raman spectra of disordered...
Ngày tải lên: 22/06/2014, 00:20
cáo khoa học: " Understanding organisational development, sustainability, and diffusion of innovations within hospitals participating in a multilevel quality collaborative" pps
... share a common, favourable assessment of task demands, resource availability, and situational factors, they share a sense of confidence that collectively they can implement a complex organisational ... that mark the start of the planning and control cycle and serve as a frame of reference for CEOs, management, and staff Performance contracts are made with unit heads to stimulate the adoption of ... patient participation in quality-management activities) and four developmental stages: (1) orientation and awareness, (2) preparation, (3) experimentation and implementation, and (4) integration...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: "Conventional and diffusion-weighted magnetic resonance imaging findings of benign fibromatous paratesticular tumor: a case report" pptx
... Received: May 2010 Accepted: May 2011 Published: May 2011 References Akbar SA, Sayyed TA, Jafri SZ, Hasteh F, Neil JS: Multimodality imaging of paratesticular neoplasms and their rare mimics Radiographics ... case of an adenomatoid tumor of the tunica albuginea evaluated by MRI [3] The tumor was also of low signal intensity on T2weighted images, with decreased enhancement after gadolinium administration, ... http://www.jmedicalcasereports.com/content/5/1/169 Page of Author details Department of Clinical Radiology, University Hospital of Ioannina, Leoforos S Niarchou, 45500, Ioannina, Greece 2Department of Urology,...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: " Highly variable pharmacokinetics of dexmedetomidine during intensive care: a case report" docx
... the interpretation of data and review of literature They also drafted and revised the manuscript All authors read and approved the final manuscript Iirola et al Journal of Medical Case Reports ... rate of infusion The concentration of any drug at a steady state is dependent only on its plasma clearance and the rate of infusion Accordingly, the calculated clearance of dexmedetomidine was ... contract research for Orion Corporation and Hospira The laboratory of MS has contract research relationships with Orion Corporation and Hospira Hospira has a license agreement with Orion Corporation...
Ngày tải lên: 11/08/2014, 11:23
báo cáo khoa học: " Does harm reduction programming make a difference in the lives of highly marginalized, at-risk drug users?" pot
... people at NYHRE who logistically set up of the research and assisted with data analysis: Eddie Rivera and Ken Teasley, Data Coordinator We also appreciate the work of AED staff and consultants: Kathryne ... 26% African American, 50% Latino, and 24% white; 72% male and 28% female; 17% ≤29 years of age; 26% between 30–39 years; and 45% ≥40 years of age First, clients participated in groups that allowed ... support to traditional drug treatment and leaves harm reduction initiatives at a disadvantage As a result, considerable research has been conducted to develop outcomes of drug treatment and assess...
Ngày tải lên: 11/08/2014, 20:20
Báo cáo y học: "Ferrets develop fatal influenza after inhaling small particle aerosols of highly pathogenic avian influenza virus A/Vietnam/1203/2004 (H5N1" pptx
... Hatta M, Yamada S, Takada A, Watanabe S, Halfmann P, Horimoto T, Neumann G, Kim JH, Lim W, Guan Y, Peiris M, Kiso M, Suzuki T, Suzuki Y, Kawaoka Y: Characterization of a human H5N1 influenza A ... daily for nasal and ocular discharge, Collection of nasal washes and virus titration Nasal washes were collected at the same time as rectal swab specimens (one collection of each/day) after anaesthesia ... rate Qsys of L/min surpasses the calculated Vm for animals by a factor of about 2.9× with a high estimate of 0.345 L/min for Vm, and a factor of 5×; with a value of 0.2 L/min The same values apply...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: "Saline lavage with substitution of bovine surfactant in term neonates with meconium aspiration syndrome (MAS) transferred for extracorporeal membrane oxygenation (ECMO): a pilot study" docx
... Surfactant lavage in a piglet model of meconium aspiration syndrome Pediat Res 1992, 31: 625–628 19 Mararo G, Bonati M, Ferrari A, Pagani C, Galibati A: A comparison of perflourocarbone with saline ... taken as the survival rate compared with the UK-ECMO trial [1], the rate of infants requiring ECMO, and the rate of intact survival (no oxygen and no major neurological handicaps at year of age) ... history, typical chest X-rays, and the green colored appearance of tracheal secretions ECMO was available at all times as a rescue therapy Informed consent of the custodians was obtained, and the IRB...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "Dominance of highly divergent feline leukemia virus A progeny variants in a cat with recurrent viremia and fatal lymphoma" pdf
... FeLV-945, a natural isolate from a cat with a multicentric lymphoma, a 21-bp tandem triplication downstream of a single copy of the enhancer was shown to confer a replication advantage and to accelerate ... 8.5 years p.i (at the age of 8.4 to 9.6 years) were available for quantitative analyses Two samples that were collected at 4.5 and 6.4 years p.i (at the age of 5.6 and 7.5 years) were analyzed ... TTA TAG CAG AAA GCG CGC G 8,281 - 8,263 Forward TAC GCC TTT ATC GCC AGT TG ATC TTT CTT CCC TTT CCT CTG G Forward AGG GAT TGC AAT CTT AGG TA Reverse gp70 CCT ATG GCT CAC TTC TTT GAT ACT GAT ATC...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: " Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants" docx
... K, Frater J, Matthews P, Payne R, Addo M, Gatanaga H, Fujiwara M, Hachiya A, Koizumi H, et al: Adaptation of HIV-1 to human leukocyte antigen class I Nature 2009, 458:641-645 Gaschen B, Taylor ... Lyagoba, P Tabuga) Spain: Hospital Clinic-IDIBAPS Univ of Barcelona Barcelona (J M Miro, M López-Dieguez, F Agüero, JA Arnaiz, T Pumarola, M Plana, M Tuset, MC Ligero, C Gil, T Gallart, JM Gatell) ... individuals in the same geographical area and demographic risk group, drawn from the SPARTAC trial and the St Mary’s Hospital Acute Infection Cohort [38], as well as the LANL UK reference database...
Ngày tải lên: 13/08/2014, 01:21
Adoption, use and diffusion of online social networks in the older population : a UK perspective
... Technology adoption, diffusion and usage research has been undertaken in a number of contexts namely: Organisations and workplaces (Harindranath et al, 2008; Forman, 2005; Thanaporn, 2009), educational ... the attitudinal factors; of advantages, enjoyment, entertainment and utilitarian benefits In addition perceived behavioral control factors of cost, lack of knowledge, lack of needs and lack of ... female heads of household for home management and financial management Computer integration in the form of computer use as part of daily routine In terms of the application of MATH, Zhang & Maruping...
Ngày tải lên: 11/10/2014, 04:00
Dynamics and characterisation of membrane fouling in a long reverse osmosis membrane channel
... enhance the accumulation of foulants on membrane surface The physical and physicochemical properties of the membrane channel can also affect the rate of membrane fouling Feed water is usually passed ... mechanisms of separation, physical morphology and materials (Aptel and Buckley 1996) In water and wastewater treatment, organic polymeric membranes are the most common types of membranes used Among ... organic polymeric materials, the two most important materials are cellulose acetate (CA) and polyamide (PA) (AWWA 1999; Baker 2000) CA membranes are low in cost and are hydrophilic They have...
Ngày tải lên: 15/09/2015, 17:10
Colloidal behavior of highly branched poss particles and development of anion exchange membrane
... cell and lithium batteries and even as a space survival material Polyimides such as Kapton® are used in spacecraft thermal blankets, solar arrays and space inflammable structures One of the major ... development of POSS particles and anion exchange membrane as well as the description of the analytical tools used in this study to characterize and analyze these particles and membrane National University ... with organic materials as they possess organic substituents The main reason of adding POSS as an additive is to improve the thermal and mechanical properties As an additive, it can also act as viscosity...
Ngày tải lên: 16/10/2015, 11:58
Actor-networks and the diffusion of management accounting innovations: A comparative study
... his entire professional career as a manager of regional companies in the East of France and Brazil, therefore far from Paris He was totally unknown and not part of the “aristocracy” of the French ... industrial companies with scientific training than to interest financial managers or accountants Such an absence of adaptation that would translate 14 accountants’ interests was undoubtedly harmful ... accounting association, similar to the British (BAA) and American (AAA) ones ECOSIP is a research group founded in 1988 and composed of companies and research labs Its aim is to exchange information and...
Ngày tải lên: 11/12/2016, 11:06