toward a molecular model of pain diagnosis and management

... Kinematic and dynamic gait compensations in a rat model of lumbar radiculopathy and the effects of tumor necrosis factor-alpha antagonism Kyle D Allen1,2, Mohammed F Shamji1,3, Brian A Mata2, ... lumbar radiculopathy Behavioral changes observed in pre-clinical models of lumbar radicular pain may relate to painful symptoms observed in human subjects Patients with low back pain and sciatica ... operated limb On day 5, animals were evaluated for spatiotemporal gait characteristics and mechanical sensitivity On day 6, animals were evaluated for dynamic gait characteristics and weight bearing...

Ngày tải lên: 12/08/2014, 17:22

... mortality was again not calculated Angus et al [9] recently calculated the predicted mortality for postoperative liver transplantation patients and found that APACHE II system overestimated mortality ... resistance, an increase in cardiac output, a decrease in pH, an increase in lactate, an increase in potassium, and a prolongation of prothrombin time [16,17] Although some of these abnormalities ... Critical Care June 2002 Vol No Arabi et al There are several obvious advantages to the use of APACHE II as a model of severity of illness for liver transplant patients These include the familiarity...

Ngày tải lên: 12/08/2014, 18:21

... is a specific feature of Bcr-Abl positive disease or a manifestation of a more general principle of cellular transformation and cancer Namely, does an oncogene act in a similar fashion within a ... constitutively active and activates a number of signal transduction pathways involved with cell proliferation and apoptosis Bcr-Abl can inhibit apoptosis and decrease cell proliferation by its kinase action ... cell can inhabit over and above its normal counterpart Let Ω represent the number of transformed states that a cell can access as a transformed cell and let ω represent the number of states that...

Ngày tải lên: 13/08/2014, 23:20

... f in novat ion A t tr ac t co m pe t ing des i gn A t tr ac t f ol l owe r Exp a nd in vest m en t A t tr ac t r ela t ed in novat ions Th r ea t en ex i st i ng in dust r y C r ea t e of co m ... t u r e I ndust r y Sh a keou t R e jec t ed des i gns D o m i nan t D e sign D om i nant D e s ign/ S tanda Yes rd D e fea t ed p l ayers D o m i nan t P l aye r P l aye r s seek ne w oppo rt ... " $,, !$ "#& " ," Acknowledgments i Summary ii Table of Contents iv List of Tables x List of Figures xi Glossary xii...

Ngày tải lên: 11/09/2015, 21:50

... caspases in apoptosis and are known as initiator caspases A phylogenetically distinct group of 13 caspases (caspase-1, caspase-4, caspase-5, caspase-11 and caspase-12) activates crucial mediators ... proteolytic cleavage into active forms Mammalian CED-3 homologues (caspase-3, caspase-6 and caspase-7) are effectors of apoptosis Caspase-2, caspase-8, caspase-9 and caspase-10, function upstream of the ... 1997 and 2003 Outbreaks have also been reported in China, Cambodia, Vietnam, Thailand and Indonesia The avian H5N1 virus resulted in a mortality rate of more than 60% (WHO 2010) and with each case...

Ngày tải lên: 13/10/2015, 16:41

... fatigue, and 2) patients facing early stages of adaptation to increased levels of fatigue Jansen and colleagues [29] confirmed these changes in internal standards of fatigue and documented changes ... to appraisal (A3 ) indicates that coping mechanisms can lead to changes in the appraisal of QOL However, catalysts (A1 ) or antecedent variables (A2 ) can also influence appraisal Regardless of ... shift has also been demonstrated in studies of the appraisal of health status In a secondary analysis of cross-sectional data, Daltroy and colleagues [41] compared a measure of function based on...

Ngày tải lên: 20/06/2014, 15:20

... ABCB8 ABCB7 ABCB6 Sav1866 ABCB4 ABCB1 ABCB5 ABCB11 ABCC12 ABCC11 ABCC5 ABCC7 ABCC4 ABCC3 ABCC1 ABCC2 ABCC6 ABCC9 ABCC8 ABCC10 ABCA7 ABCA1 ABCA4 ABCA2 ABCA3 ABCA13 ABCA12 ABCA10 ABCA9 ABCA6 ABCA5 ABCG4 ... ABCB, ABCC, ABCD and ABCG Two main branches are seen, with ABCB, ABCC and ABCD in one branch, and ABCA and ABCG in the other branch ABCB and ABCC subfamilies are closer related to each other than ... Val410 TMH4 TMH5 B Figure Ligand interaction areas Ligand interaction areas Close-up of putative ligand interaction areas of ABCB1 (Panel A) and ABCC5 (Panel B) The view is a cross-section of...

Ngày tải lên: 13/08/2014, 16:21

... Major pathways for pain sensation from the body Adapted from Purves and Williams, 2001 13 Chapter I Introduction Orofacial pain Orofacial pain is defined by the American Academy of Orofacial Pain ... complement cascade (C 3a and C 5a) and vasodilators such as vasoactive amines and bradykinin Blood-borne neutrophils, monocytes and T lymphocytes adhere to the vessel walls, extravasate and accumulate at ... regulate synaptic activity (Ren and Dubner, 2010) Animal models of orofacial pain The use of questionnaires and scales, are reliable, accurate and versatile for the measurement of both experimental...

Ngày tải lên: 10/09/2015, 08:34

... atypical oral and facial pain includes a variety of pain descriptions like phantom tooth pain (Turp 2005), atypical odontalgia (Grushka et al 2003; Baad-Hansen et al 2005), atypical facial neuralgia ... diagnosis of orofacial pain is complicated because of the region’s density of anatomical structures, rich innervations and high vascularity Orofacial pain is defined by the American Academy of ... of Orofacial Pain (AAOP) as pain conditions that are associated with the hard and soft tissues of the head, face, neck, and all the intraoral structures” (Okeson 1996) Most prevalent pain in...

Ngày tải lên: 14/09/2015, 08:42

... infection and neoplasms Neuralgic pain is generally expressed in the facial area as idiopathic trigeminal neuralgia The ill-defined category of atypical oral and facial pain includes a variety of pain ... grade of categories of behavior j= probes of von Frey hair filament This converts the ordinal scale data to ratio scale data Ratio scale data is a type of cardinal data Cardinal data are on a ... neuropathies and central pain states Phases of Pain There are three phases of pain known: (a) Phase (Acute Nociceptive Pain) The mechanism involved can be viewed as a simple and direct route of transmission...

Ngày tải lên: 05/10/2015, 13:53

... sequence of rat TLR4 (GenBank accession NM_019178) were: 5’-CUACCAACAGAGAGGAUAU-3” (siRNA1), 5’-GUCUCAGAUAUCUAGAUCU-3’ (siRNA2), 5’-GAGCCGGAAAGUUAUUGUG-3’ (siRNA3) All siRNAs were chemically synthesized ... once daily for days, starting from day before CCI surgery Evaluation of tactile allodynia and thermal hyperalgesia The paw withdrawal latency (PWL) to radiant heat and paw withdrawal threshold (PWT) ... system (Amersham Pharmacia Biotech, Uppsala, Sweden) Histone3 (Sigma, St Louis, MO, USA, 1:500) was used as an internal control Statistical analyses Data are expressed as mean ± standard deviation...

Ngày tải lên: 25/10/2012, 11:48

... Pro transmission scanner (Epson, Nagano, Japan) and analyzed with imagemaster 2d platinum software, version 5.0 (GE Healthcare) Spots were detected automatically by the software and manually refined; ... Germany) Capillary voltage was 1.5–2 kV and a dry gas flow rate of 10 LÆmin)1 was used with a temperature of 230 °C The scan range was 300–1800 m ⁄ z The tandem mass spectra were annotated and peak list ... Complex Change in pattern Change in pattern a Theoretical values b F and P refer to ANOVA c Identified from SWISS 2D-PAGE database dehydrogenase and to mitochondrial ATP synthase a subunit by comparison...

Ngày tải lên: 15/02/2014, 01:20

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...

Ngày tải lên: 19/02/2014, 05:20

... can be calculated as follows: ELISA assays were carried out using rabbit antibodies raised against the recombinant proteins [12,14] and puried proteins as standards We measured that an extract ... Systems Modelling Database and can be accessed at http://jjj.biochem.sun.ac.za/ database/curien/index.html free of charge Fig Phser branch-point in the aspartate-derived amino acid biosynthetic pathway ... ẵAdoMet ẵPi 1ỵ 1:1 C B ẳ@ ỵ Pi A KiTS ỵ ẵAdoMet 140 8ị 9ị noAdoMet AdoMet Where, kcatTS and kcatTS are the TS catalytic constant in the absence and presence of a saturating concentration of AdoMet,...

Ngày tải lên: 20/02/2014, 02:21

... were available 4-8 weeks later As no single gold standard was available for comparison of the performance of the individual tests, an analysis of results was done using a variety of standards ... culture and PCR KAVITA MODI – PAREKH ET AL weeks Characterization of Mycobacteria was done at the Corporation laboratory by primary differential tests for atypical Mycobacteria Statistical analysis ... respiratory diseases other than tuberculosis (Table 1A serial-c) These cases were as follows, two each of asthma, pneumonia and cancer lung, one each of post CABG, COPD and lung abscess and 12...

Ngày tải lên: 06/03/2014, 04:20

... Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG ... AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG AAAGACACG AAAGACATA + ND ND – – + ND ND ND + – – – – + – + – 0.25 1.5 p=0.01 60_HI 60M_HI Fig The caspase-1 gene upstream ... namely AGAGACATG (P2), AAGGACATG (P3), AAATACATG (P4), AAAGCCATG (P5), AA AGAGATG (P6), AAAGACCTG (P7), AAAGACACG 3896 Cloning of the Hippi pDED domain and N-terminal domain of Hippi in the bacterial...

Ngày tải lên: 07/03/2014, 10:20

... modern dance, abstract art and classical music are rather low on this dimension Situation and context are presumably more important in opera and theatre and less important in books and music and any ... forms of visual art is the combination of visual processing, extraction of meaning and resolution of ambiguity We assume that classical, representational art and most kinds of sculptures are processed ... Conceptual ideas, stylistic reflections and variations, as well as abstract concepts no longer apparent from the appearance of the artwork have become increasingly dominant in contemporary art This aspect...

Ngày tải lên: 07/03/2014, 17:20

... exceptions are Hendel and Nevo (2006) and Hartmann and Nair (2008) 3 theoretical (Becker and Murphy 1988), empirical (Tauras and Chaloupka 1999), and experimental work (Donegan et al 1983, Peele ... both contain three large brands that occupy different price tiers and account for more than 80% of sales For crackers, Nabisco is the dominant brand with a market share of nearly 50% and a sales-weighted ... “Rational Addiction and Rational Cessation: A Dynamic Structural Model of Cigarette Consumption,” Working paper, Yale University Chaloupka, F J (1991), “Rational Addictive Behavior and Cigarette...

Ngày tải lên: 16/03/2014, 09:20

... Erwin Marsi Antal van den Bosch and Abdelhadi Soudi 2007 Memory-based morphological analysis and partof-speech tagging of arabic In Abdelhadi Soudi, Antal van den Bosch, and Gunter Neumann, editors, ... lexical database Kristina Toutanova and Mark Johnson 2008 A bayesian LDA-based model for semi-supervised part -of- speech tagging In nips08 Antal Van Den Bosch and Walter Daelemans 1999 Memory-based ... this paper we concentrated on the task of morphological analysis, given a lexicon and unannotated data We showed that the tasks of tag prediction and lemmatization are strongly dependent and that...

Ngày tải lên: 17/03/2014, 01:20

... kanji katakana katakana-kanji kanji-hiragana hiragana kanji-katakana kat akana-symbol-katakana number kanji-hiragana-kanji alphabet kanji-hir agana-kanji-hir agana hiragana-kanji percent 45.1% 11.4% ... < a l p h a > , < h i r a > , < k a t a > , and < k a n > represent a sequence of symbols, numbers, alphabets, hiraganas, katakanas, and kanjis, respectively < k a n - h i r a > and < h i r a ... speech Table shows examples of common charto Chinese characters Hiragana and katakana are acter bigrams for each part of speech in the infresyllabaries: The former is used primarily for grammatical...

Ngày tải lên: 23/03/2014, 19:20