toward a culturally and historically informed strategy

Báo cáo y học: " Focused nurse-defibrillation training: a simple and cost-effective strategy to improve survival from in-hospital cardiac arrest" pptx

Báo cáo y học: " Focused nurse-defibrillation training: a simple and cost-effective strategy to improve survival from in-hospital cardiac arrest" pptx

... American Heart Association: Textbook of Advanced Cardiac Life Support Dallas: American Heart Association, 1994 10 American Heart Association: 2005 American Heart Association Guidelines for Cardiopulmonary ... 48(2):105-110 American Heart Association: 2005 American Heart Association Guidelines for Cardiopulmonary Resuscitation and Emergency Cardiovascular Care Part 7.2: Management of cardiac arrest Circulation ... survival from in-hospital cardiac arrest Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2010 18:42 Submit your next manuscript to BioMed Central and take full advantage of:...

Ngày tải lên: 13/08/2014, 23:20

4 241 0
Young Men’s Sexual AND Reproductive Health: Toward a National Strategy Getting Started potx

Young Men’s Sexual AND Reproductive Health: Toward a National Strategy Getting Started potx

... and develop positive values and motivation to act on those values u Provide access to clinical care, as appropriate 26 Young Men’s Sexual and Reproductive Health: Toward a National Strategy A ... u A clearinghouse to inventory and collate information about existing program approaches and to make them readily accessible to programs and program planners u Training and technical assistance ... community agencies and program planners u Forums in which innovative ideas and practices can be shared u Dissemination of information and program promotion Build a Stronger Research and Evaluation Base...

Ngày tải lên: 14/03/2014, 15:20

185 485 0
Toward a Green, Clean, and Resilient World for All: A World Bank Group Environment Strategy 2012 – 2022 ppt

Toward a Green, Clean, and Resilient World for All: A World Bank Group Environment Strategy 2012 – 2022 ppt

... Fernando Loayza, Valerie Hickey, Klas Sander, Yves Prevost, Hannah Behrendt, Urvashi Narain, Giovanni Ruta, Alejandra Alvarez, and Kazi Fateha Ahmed from the World Bank and Edmond Mjekiqi and ... Sobczynska The Task Team Leader for preparation of the Strategy was Yewande Aramide Awe The Strategy drafting group, led by Elisabeth Mealey, included Laura Tlaiye, Yewande Aramide Awe, Habiba Gitay, ... and logistical support was provided by Grace Aguilar, Sharon Esumei, Liudmila Mazai, Alexandra Sears, Regina Vasko, Patricia Noel, Nyambura Thande, and Juliette Makandi Guantai We thank the Governments...

Ngày tải lên: 29/03/2014, 08:20

116 426 0
Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt

Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt

... with a quick glance Patients assume active role in their health care Implementation: The Asthma Task Force developed an Asthma Test, Asthma Management Plan, and Asthma Action Plan The Asthma Test ... Culturally and Linguistically Competent Health Education Materials 7/6/07 19 AHRQ Learning Partnership to Decrease Disparities in Pediatric Asthma Native-American Families 1) In Navajo asthma ... morbidity, and mortality among African Americans as compared with Caucasians, the study was designed to identify alternative beliefs and behaviors To identify causal models of asthma and the context...

Ngày tải lên: 14/02/2014, 13:20

24 525 0
Tài liệu COUNSELING and PSYCHOTHERAPY with ARABS and MUSLIMS A Culturally Sensitive Approach doc

Tài liệu COUNSELING and PSYCHOTHERAPY with ARABS and MUSLIMS A Culturally Sensitive Approach doc

... earth “Wabtag i fema a tak Allah al-dar el-aakhera wala tansa nasibak men al-dunia” (Al-Qusas #77) [But seek, by means of that which God has given you, to attain the abode of the hereafter and ... happen to anybody This belief is documented in the verse, “Qol lan yosibuna illa ma katab Allah lana howa mawlana wa ala Allah falyatawakal el-mo amenin” (Al-tawbah #51) [Say: Nothing will befall us ... authoritarian/collective and liberal/individualistic societal models For instance Malaysia, Pakistan, Saudi Arabia, and Libya are more authoritarian and collective than Lebanon, Turkey, Tunis, and...

Ngày tải lên: 15/02/2014, 15:20

187 333 0
Báo cáo khoa học: "A Strategy for Dynamic Interpretation: a Fragment and an Implementation" pot

Báo cáo khoa học: "A Strategy for Dynamic Interpretation: a Fragment and an Implementation" pot

... to be at work A man I walked in Another man~ walked ont Hez was angry (15) A man walked in John saw the man Example (15) has a natural reading where the definite description is anaphorically linked ... metamodule Evaluation and an object program Logic Database, and the meta-program manipulates the object program We translate first order conditions into G6del goals, and then apply the goal to the ... as "John saw a man" is a program which associates John with a variable z , a m a n with a variable y, and first checks whether the value of x equals John, next puts a value in y which satisfies...

Ngày tải lên: 09/03/2014, 01:20

10 366 0
Strategic thinking: A nine step approach to strategy and leadership for managers and marketers

Strategic thinking: A nine step approach to strategy and leadership for managers and marketers

... organizations, and by managers of large multinational companies and international NGOs It is popular with final-year undergraduates and MBA and Master's students of business, management and marketing ... the marketing team Total immersion encouraged a rapid growth of market and technical expertise and this favoured commercially patentable innovation (Step of The 9S©Approach) Bureaucracy and administrative ... institutions, democracy, hierarchies and ways of thinking that have largely proved to be accurate This was because he had knowledge about changes that had already taken place at the time he made his predictions...

Ngày tải lên: 15/03/2014, 15:33

159 1,2K 0
Assuring Access in Key Strategic Regions - Toward a Long-Term Strategy docx

Assuring Access in Key Strategic Regions - Toward a Long-Term Strategy docx

... anti-access study with us xxi Glossary AB AMC APOD APOE APS ARCENT ARPAC ARSOUTH ASAT ASW ATACMS AWACS BCT C2 CBRNE CENTCOM CEP CONUS EMP Air Base Air Mobility Command Aerial Point of Debarkation ... • “Anti-Access in a Baltic Scenario,” 2003; “Anti-Access in a SWA Scenario,” 2003; “Anti-Access in a PRC-Taiwan Scenario,” 2003; and “Anti-Access Strategies: A Quantitative Analysis of Military ... to APODs and SPODs, and onward movement toward the tactical area Our assumption was that, in theory at least, an adversary could direct attacks or other actions against any of the nodes or arcs...

Ngày tải lên: 15/03/2014, 20:20

187 251 0
SITUATION MODELS AND LEVELS OF COHERENCE: Toward a Definition of Comprehension potx

SITUATION MODELS AND LEVELS OF COHERENCE: Toward a Definition of Comprehension potx

... resources available to so, and one crucial question that arose was what elements are activated at a particular point in the reading These two constraints, related to inference making (or the lack of ... that are on the causal chain are better recalled than those that are located at dead-ends (i.e., assumed to be outside the causal chain) In the second theoretical approach (see Kintsch & van ... Zwaan & Radvansky, 1998), and the concepts of states and events (Molinari & Tapiero, in press; Zwaan, Langston, & Graesser, 1995), two crucial semantic categories that are embedded in temporocausal...

Ngày tải lên: 24/03/2014, 02:20

252 447 0
IMPACT OF MATERNAL AND CHILD HEALTH STRATEGY ON CHILD SURVIVAL IN A RURAL COMMUNITY OF PONDICHERRY pptx

IMPACT OF MATERNAL AND CHILD HEALTH STRATEGY ON CHILD SURVIVAL IN A RURAL COMMUNITY OF PONDICHERRY pptx

... prevention and management of birth asphyxia in the community: In: A Global Strategy for Prevention and Management of Birth Asphyxia Through Maternal and Newborn Care at Primary Health Care Level ... Ed Pandurangi R Sheffield, Commonwealth Association of Mental Handicap and Developmental Disabilities, 1991; pp 47-51 13 Anderson GC, Marks EA, Wahlberg B Kangaroo care for premature infants Am ... birth attendants and health worker females on neonatal resuscitation and neonatal care has been successfully field tested in Chandigarh, India(12) and needs to be emphasized, 790 MCH STRATEGY...

Ngày tải lên: 28/03/2014, 11:20

8 403 0
SLOW  FOOD  AND  HOME  COOKING:  TOWARD  A  RELATIONAL  AESTHETIC  OF FOOD AND RELATIONAL ETHIC OF HOME   pdf

SLOW  FOOD  AND  HOME  COOKING:  TOWARD  A  RELATIONAL  AESTHETIC  OF FOOD AND RELATIONAL ETHIC OF HOME   pdf

... Allen and Sachs (2007) and Micheletti (2006) note that women are activists in new  agrifood  movements;  and Slow  Food  has  some  very  prominent  women  in  its  leadership—e.g.,Wangari  Maathai,  Vandana  Shiva,  and Alice  Waters.  Allen  ... the agrifood movement‐‐‐the pleasures of food and,  by extension, the sensual and relational qualities of an aesthetic of food.   SLOW FOOD AND HOME COOKING IN ITALY  Italy  and the  United  States  are  paradigmatic  cases  with  which  to  analyze  gendered food practices in relationship to slow food and home cooking (Fischler  ... NJ: Transaction Publishers) pp. 245‐264.  Miele, Mara and Jonathan Murdoch 2003. “Fast Food/Slow Food: Standardizing and Differentiating Cultures of Food” in Globalization, Localization and Sustainable ...

Ngày tải lên: 30/03/2014, 16:20

23 220 0
the mit press toward a science of consciousness iii the third tucson discussions and debates oct 1999

the mit press toward a science of consciousness iii the third tucson discussions and debates oct 1999

... part of physical reality They cannot say that it too is just an appearance, and not part of how things are, on pain of infinite regress They must grant that it is itself a reality, and a reality ... may be a manifestation of the nonspatial nature of pre Big Bang reality Later, and more moderately, he says that consciousness "tests the adequacy of our spatial understanding It marks the place ... consciousness may be tied to the internal aspect of physical causation, giving it a deep and fundamental place in the natural order Many more papers on these issues can be found in Block, Flanagan, and...

Ngày tải lên: 11/06/2014, 13:53

455 288 0
temple univ pr food and evolution toward a theory of human food habits jan 1987

temple univ pr food and evolution toward a theory of human food habits jan 1987

... Bangladesh (Lindenbaum), Amazonia (Johnson and Baksh, Good, Ross), Paraguay (Hawkes), Canadian sub-arctic (Winterhalder), Southeast Asia and Africa (Franke), Mexico (Pelto), Costa Rica (Edelman), ... Scotland, from Wales and from Ireland, from Denmark and from Holland [There are also] bacon and salt meat from Ireland; hams from Yorkshire and Germany and Spain; game from all the sporting ... Wilbert has observed of the Warao of the Orinoco delta "that some of the nutritionally most valuable game animals, especially tapir, and here and there also deer and paca, are traditionally tabooed"...

Ngày tải lên: 11/06/2014, 16:29

645 298 0
Health and Quality of Life Outcomes BioMed Central Review Open Access Toward a theoretical model ppt

Health and Quality of Life Outcomes BioMed Central Review Open Access Toward a theoretical model ppt

... fatigue, and 2) patients facing early stages of adaptation to increased levels of fatigue Jansen and colleagues [29] confirmed these changes in internal standards of fatigue and documented changes ... physical and mental health tended to recalibrate their standards for comparing health states in a manner that downplayed current personal problems, and small gains were more valuable to disabled ... likelihood and type of catalysts and mechanisms of appraisal Mechanisms (c) encompass behavioral, cognitive, or affective processes to accommodate changes in catalysts (initiating social comparisons,...

Ngày tải lên: 20/06/2014, 15:20

12 222 0
báo cáo hóa học:" The positive mental health instrument: development and validation of a culturally relevant scale in a multi-ethnic asian population" pdf

báo cáo hóa học:" The positive mental health instrument: development and validation of a culturally relevant scale in a multi-ethnic asian population" pdf

... taking into account the phrasing of the items and their meaning Exploratory factor analysis (EFA): The sample was randomly divided into two halves; one each for EFA and CFA EFA for all 182 candidate ... Cite this article as: Vaingankar et al.: The positive mental health instrument: development and validation of a culturally relevant scale in a multi-ethnic asian population Health and Quality of ... scale, and after evaluating different transformations, decided that a dichotomous scale resulting from collapsing categories 1-3 into a single category and leaving category as is was optimal...

Ngày tải lên: 20/06/2014, 15:20

18 487 0
Exposure Science in the 21st Century: A Vision and A Strategy potx

Exposure Science in the 21st Century: A Vision and A Strategy potx

... Disease Control and Prevention, the National Oceanic and Atmospheric Administration, the National Science Foundation (NSF), and the National Aeronautics and Space Administration—to promote greater ... to build capacity to  Assess and mitigate exposures quickly in the face of emerging environmental-health threats and natural and human-caused disasters  Predict and anticipate human and ecologic ... manufacture, distribution, and sale of products Societal demands for exposure data arise from the aspirations of individuals and communities—relying on an array of health, safety, and sustainability...

Ngày tải lên: 28/06/2014, 20:20

157 259 0
A Balanced Scorecard Approach for Strategy- and Quality-driven pptx

A Balanced Scorecard Approach for Strategy- and Quality-driven pptx

... Organization; and (9) Using Scorecard Information to Evaluate and Improve Performance To computerize data means dealing with several issues such as data quality, validation, and ownership Cascading ... originally designed in 1990 by Kaplan and Norton [5]), a strategic management system, and a communication tool involving all academic stakeholders into a new culture of strategy and quality awareness” ... necessary information to increase their ability to analyse, plan, and react In spite of the large volume of data gathered from transactional databases (operational systems) and the existing information...

Ngày tải lên: 07/08/2014, 02:20

6 390 1
Báo cáo y học: "Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling" pps

Báo cáo y học: "Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling" pps

... 0.997 2.05 CCCCGAGGGCTGTGCTA TGAACTTCAACTGGAACAGGGTATC Aggrecan 0.992 2.15 TCTACCCCAACCAAACCGG AGGCATGGTGCTTTGACAGTG Collagen X 0.992 1.97 CACACTCTGTCCTCGTGCTTTG GGAATCCCTGTAAGACACACCAA Mice were ... 2.05 GGCAAATTCAACGGCACA GTTAGTGGGGTCTCGCTCCTG Collagen IA 0.997 2.10 TGACTGGAAGAGCGGAGAGTACT CCTTGATGGCGTCCAGGTT Collagen II 0.992 2.15 TTCCACTTCAGCTATGGCGA GACGTTAGCGGTGTTGGGAG Collagen III ... the tibia and the patella Aggrecan mRNA was highest on day 7, with 13- and 15-fold increases on the patella and the tibia, respectively On the patella, collagen type II mRNA had reached a 17-fold...

Ngày tải lên: 09/08/2014, 10:21

11 401 0
báo cáo khoa học: " Toward a treaty on safety and cost-effectiveness of pharmaceuticals and medical devices: enhancing an endangered global public good" pot

báo cáo khoa học: " Toward a treaty on safety and cost-effectiveness of pharmaceuticals and medical devices: enhancing an endangered global public good" pot

... countries and impact on pharmaceutical research and development[76] Toward a multilateral treaty It seems remarkable, in an age of corporate globalisation, that medicines and medical devices national ... Cost-effectiveness evaluation was introduced as a interrelated evaluation with safety and efficacy approval, by the Canadian provinces of Ontario[17] and British Columbia in the early 1990's[18] The Canadian Expert ... SM: 'Pharmaco-economics and outcomes research in Pakistan''Pharmaco-economics and outcomes research in Malaysia' International Society for Pharmacoeconomics and Outcomes Research 2nd Asia-Pacific...

Ngày tải lên: 11/08/2014, 18:20

9 448 0
báo cáo khoa học: " Roadside sobriety tests and attitudes toward a regulated cannabis market" pdf

báo cáo khoa học: " Roadside sobriety tests and attitudes toward a regulated cannabis market" pdf

... 'oppose', or 'not sure' Data analyses Because published data on attitudes about a taxed and regulated cannabis market in America are extremely sparse, we began with simple bivariate analyses Our focus ... each question to predict whether a participant was likely to agree to a regulated cannabis market as a function of gender, age, education, Democratic party affiliation, and being Caucasian Although ... would alter their opinion regarding a regulated cannabis market after learning of a roadside impairment test Again, gender, age, education, Democratic-party affiliation, and being Caucasian were...

Ngày tải lên: 11/08/2014, 18:20

6 264 0
w