total closing of a paper mill with deinkinc and clarification installations
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt
... case, because an oxidative degradation of the catalyst occurred This was shown by a progressive disappearance, in its absorption spectrum, of the soret band at 396 nm that is characteristic of ... such as nitrosoalcane, to the iron of MP8, it brings a partial steric hindrance on the distal face of MP8 and thus controls access of the nitrosoalcane ligand to the iron atom of MP8 Such a phenomenon ... of MP8 [22], replacing the labile H2O ligand in the sixth coordination position of the iron, to produce a very stable and catalytically inactive hexacoordinate Fig Activators and inhibitors of...
- 7
- 447
- 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... (This data was obtained with the commands InvariantRing, PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that R = R/f1 R is an integral domain Let S be the subring of R generated ... Bhargava, The density of discriminants of quartic rings and fields, Ann of Math 162 (2005), 1031–1063 [3] ——— , The density of of discriminants of quintic rings and fields, Ann of Math., to appear ... Annals of Mathematics, 163 (2006), 723–741 The number of extensions of a number field with fixed degree and bounded discriminant By Jordan S Ellenberg and Akshay Venkatesh* Abstract We give an...
- 20
- 478
- 0
Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc
... ADP fi ACA + ATP ACA + NADH fi NAD+ ATP fi ADP Glc + ATP fi ADP trioseP + NADH fi NAD+ ACA Ð ACA x ACAx fi GAPDH: lowpart: ADH: ATPase: storage: glycerol: difACA: outACA: V2 ½Glc½ATP 1þ ½ATP Ki ... Modelling Database and can be accessed at http://jjj.biochem.sun ac.za/database/hynne/index.html, http://jjj.biochem.sun.ac za/database/dano1/index.html, http://jjj.biochem.sun.ac za/database/dano2/index.html ... [NAD+] k4[BPG] [ADP] k5[ACA] [NADH] k6[ATP] k7[Glc] [ATP] k8[trioseP] [NADH] k9([ACA] ) [ACAx]) (k0 + k10) [ACAx] ACA) was changed so that it is now formally composed of the ACA leaving the reactor...
- 16
- 492
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...
- 11
- 548
- 0
báo cáo hóa học:" Comparison of a minimally invasive posterior approach and the standard posterior approach for total hip arthroplasty A prospective and comparative study" doc
... the statistical analysis PS participated in the study and analyses of the study Page of JS participated in the study and analyses of the study All authors read and approved the final manuscript ... incision approach If one accepts that the muscle enzyme values are meaningful parameters, then this could mean on one hand that the degree of trauma associated with minimally invasive and standard ... other studies that compared various minimally invasive approaches and the standard approach to total hip replacement [6,15,20,37,38] Fink et al Journal of Orthopaedic Surgery and Research 2010, 5:46...
- 7
- 434
- 0
báo cáo hóa học:" Meaning in life in the Federal Republic of Germany: results of a representative survey with the Schedule for Meaning in Life Evaluation (SMiLE)" ppt
... significantly higher levels of family life satisfaction and community satisfaction [35] Inhabitants of the affluent German South-West (BadenWuerttemberg, Bavaria, Hesse/Rhineland-Palatinate/Saarland, ... spirituality and least satisfied with work and finances Health, partnership, and family were rated as most important for MiL, home/garden and leisure time were least important In multifactorial analyses ... Included are number and percentage of the listings as well as mean and standard deviation (SD) of the importance and satisfaction ratings wi si n Family Work Leisure time Friends Health Partnership...
- 8
- 382
- 0
báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx
... [9] from a GLRT approach under a Gaussian noise assumption and assuming the total noise covariance matrix and the useful propagation channel are two unknown parameters The advantages of this detector ... without a TNAR We assume in this section that parameters µs, φs, R, C and s are unknown and that no TNAR is available Under both these assumptions and A1 , A2 , matrices R and C may be estimated from ... estimated from secondary data only In a same way, the knowledge of a TNAR allows to increase the performance in comparison with an absence of TNAR Finally, for a given set of total noise parameters,...
- 45
- 467
- 0
Báo cáo hóa học: " Research Article Existence and Stability of Antiperiodic Solution for a Class of Generalized Neural Networks with Impulses and Arbitrary Delays on Time Scales" ppt
... scale,” Journal of Mathematical Analysis and Applications, vol 319, no 1, pp 315–325, 2006 35 R Agarwal, M Bohner, and A Peterson, “Inequalities on time scales: a survey,” Mathematical Inequalities ... user, Boston, Mass, USA, 2001 a 32 M Bohner and A Peterson, Advances in Dynamic Equations on Time Scales, Birkh¨ user, Boston, Mass, a USA, 2003 33 V Lakshmikantham and A S Vatsala, “Hybrid systems ... scales,” Journal of Computational and Applied Mathematics, vol 141, no 1-2, pp 227–235, 2002 34 E R Kaufmann and Y N Raffoul, “Periodic solutions for a neutral nonlinear dynamical equation on a...
- 19
- 481
- 0
Báo cáo hóa học: " Whispering gallery modes in photoluminescence and Raman spectra of a spherical microcavity with CdTe quantum dots: anti-Stokes emission and interference effects" ppt
... of fast Fourier analysis adjacent TE and TM modes) again in agreement with measured modes separation (Fig 3a) Periodicities of 0.44 and 0.33 nm, obtained from the Fourier analysis, are indicative ... indicative of the TE and TM modes with radial order numbers which are greater than We also studied the optical behavior of the microcavity-quantum dot system with excitation below the band gap of the ... allow a comparison with the experimental data The spacing is measured between the first and the second peak, respectively, of two adjacent pairs The analytical equation using expansions of the Bessel...
- 6
- 329
- 0
ON WEAK SOLUTIONS OF THE EQUATIONS OF MOTION OF A VISCOELASTIC MEDIUM WITH VARIABLE BOUNDARY V. G. pptx
... approximation of the equation in a weak sense and application of the topological theory of a degree that allows to establish the existence of solutions on the basis of a priori estimates and statements ... Kamenski˘, A S Potapov, A E Rodkina, and B N Sadovski˘, Measures ı ı of Noncompactness and Condensing Operators, “Nauka” Sibirsk Otdel., Novosibirsk, 1986 K Amedodji, G Bayada, and M Chambat, On ... Zvyagin: Department of Algebra and Topological Methods of Analysis, Faculty of Mathematics, Voronezh State University, Universitetskaya pl 1, 394006 Voronezh, Russia E-mail address: zvg@main.vsu.ru...
- 31
- 266
- 0
Báo cáo toán học: "Note on generating all subsets of a finite set with disjoint union" potx
... family G ⊂ P[n] a k-base of P[n] if every x ⊂ [n] can be expressed as a union of at most k sets in G; they conjectured that for any k ≤ n, any k-base of P[n] is at least as large as Fn,k ... generalization of a theorem of Alon and Frankl, proved via an Erd˝s-Stone o type result As observed in [1], for a k-generator G, we have the following trivial bound on |G| = m The number of ways of ... Nikiforov (a slight weakening of Theorem in [4]): Theorem Let a ≥ 2, ca log n ≥ Then any graph on n vertices with at least cna Ka ’s contains a Ka (t) with t = ⌊ca log n⌋ We see that provided...
- 6
- 215
- 0
Báo cáo toán học: "A Decomposition Algorithm for the Oriented Adjacency Graph of the Triangulations of a Bordered Surface with Marked Point" potx
... a signed adjacency matrix associated to an ideal triangulation of a bordered surface with marked points (S, M), and G is a quiver If B(G) = B, we say G is the oriented adjacency graph associated ... to a triangulation of a bordered surface with marked points is finite (Corollary 12.2 in [2]) It is also proved in [2] that an integer matrix B is an adjacency matrix of an ideal triangulation of ... blocks Each elementary block is uniquely associated to a triangulation of a piece of surface Gluing elementary blocks corresponds to a gluing of associated triangulated pieces of surfaces along arcs...
- 45
- 262
- 0
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc
... F, Vieta E, Martínez-Arán A, Garcia-Garcia M, Reinares M, Torrent C, Goikolea JM, Banús S, Salamero M: Spanish version of a scale for the assessment of mania: validity and reliability of the ... Juan José Uriarte, and Fermín Mayoral for their contribution in the linguistic validation Author details Department of Psychiatry, Hospital Universitario de Salamanca, Salamanca, Spain 2Department ... established (that is, schizophrenic and bipolar patients) with 80% power and a 5% significance level (2-sided tests), involving 68 patients per group Data tabulation, database validation and...
- 8
- 476
- 0
báo cáo khoa học: "Kaposiform hemangioendothelioma in tonsil of a child associated with cervical lymphangioma: a rare case report" pptx
... hemangioma [11] A similar coexistence of lymphangiectasia with vascular tumor nodules is seen in a tufted angioma KHE and tufted angioma are probably same part of the spectrum Cases of an acquired ... lack of nuclear atypia and mitosis within tumor cells, along with HHV8 negativity This reinforces lack of a common pathway for a Kaposiform hemangioendothelioma and a Kaposi’s sarcoma In spite of ... neck, associated with episodes of pain and swelling in his throat, since birth One of the episodes was severe that led to acute dyspnoea and dysphagia that was clinicoradiologically diagnosed as a...
- 8
- 471
- 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating ... http://arthritis-research.com/content/7/1/R19 (ANA) profile (Pharmacia Diagnostics; cutoff ratio 1) The latter assay contains the autoantigens U1-68 kDa, U1 -A, U1-C, SmBB', SmD, Ro-52, Ro-60 and La All ELISAs were performed in accordance ... from an east Indian patient, and one from an oriental patient The racial background of four patients was not known Of these patients, 13 were male and 86 female (in two the sex was unknown), and...
- 11
- 593
- 0
Báo cáo y học: "Circadian phase-shifting effects of a laboratory environment: a clinical trial with bright and dim light" ppsx
... Journal of Circadian Rhythms 2005, 3:11 Figure Circadian malsynchronization at baseline and final assessment Circadian malsynchronization at baseline and final assessment Shown is circadian malsynchronization, ... ages 20–40), mean and SE Age Group Baseline aMT6s Acrophase Final aMT6s Acrophase Baseline Circadian Malsynch Final Circadian Malsynch Baseline Circadian Dispersion Final Circadian Dispersion ... median aMT6s acrophase for his/her age group These measures were calculated for both baseline and final aMT6s acrophase data Baseline measures of circadian malsynchronization and phase dispersion...
- 9
- 462
- 0
báo cáo khoa học: "The cadaver of a Caucasian man with a supernumerary fourth dorsal interosseous muscle in the right hand: a case report" ppt
... publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Author details Department of Anatomy, Medical ... The compartments of the hand: an anatomic study J Hand Surg Am 1998, 23:682-686 Jacobson MD, Raab R, Fazeli BM, Abrams RA, Botte MJ, Lieber RL: Architectural design of the human intrinsic hand muscles ... et al.: The cadaver of a Caucasian man with a supernumerary fourth dorsal interosseous muscle in the right hand: a case report Journal of Medical Case Reports 2011 5:393 Submit your next manuscript...
- 2
- 221
- 0
Báo cáo y học: " Coexistence of a colon carcinoma with two distinct renal cell carcinomas: a case report" pps
... Renal cell carcinoma Esophageal carcinoma Kobayashi et al [6] Papillary renal carcinoma Heart liposarcoma Gałazka et al [7] Renal oncocytoma Endometrioid ovarian and endometrial carcinoma Bezircioğlu ... Y, Yamada T, Miyashiro I, Murata K, Hiratsuka M, Kameyama M, Ohigashi H, Sasaki Y, Ishikawa O, Imaoka S: Synchronous esophageal and renal cell carcinoma Dis Esophagus 2000, 13:305-310 Gałazka K, ... cancer Indian J Gastroenterol 2000, 19:35-36 19 Adachi Y, Takamatsu H, Noguchi H, Tahara H, Fukushige T, Takasaki T, Yoshida A, Kamenosono A, Kikuchi J, Asatani M, Kawakami K: A malignant rhabdoid...
- 6
- 348
- 0
báo cáo khoa học: "Development of a duodenal gallstone ileus with gastric outlet obstruction (Bouveret syndrome) four months after successful treatment of symptomatic gallstone disease with cholecystitis and cholangitis: a case report" pps
... the day of admission revealed a normal pancreatic duct and a small pigmented gallstone of the CBD that was extracted with an extraction balloon after endoscopic Page of Table Laboratory data for ... count of 14.3 cells/nL, an elevated C-reactive protein (CRP) level of 25.9 mg/dL, mildly elevated plasma aspartate aminotransferase and alanine aminotransferase (AST and ALT) levels of 51 U/L and ... on a CT scan and because we were planning a one-stage surgery, we performed a laparotomy instead of choosing a laparoscopic approach Conclusion In a patient with gallstone disease with abdominal...
- 5
- 272
- 0
báo cáo khoa học: " 3-D reconstruction of a human fetus with combined holoprosencephaly and cyclopia" pptx
... 2) Both maxillae were hypoplastic, with three tooth anlagen on each side Between the maxillae the anlage of a single midaxial incisor was found (Fig 3a) No nasal septum or nasal cavity was present; ... studied with a Leitz DMRB microscope (Leica, Wetzlar, Figure Photographs of the macroscopic appearance of the head Photographs of the macroscopic appearance of the head a) Frontal view of the ... Holoprosencephaly seems to be a malformation of the most rostral parts of the brain and the cranium, as it affects mainly the telencephalon and the upper portion of the facial cranium From the results of...
- 11
- 292
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25