... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... near the cathode side area The maximum stress appears in the cathode side surface of the membrane, implying that major heat generation takes place near this region It can be seen also that the ... mechanical, thermal, and electrical contact between the central parts of the gas diffusion backing and Membrane-Electrode-Assembly (MEA) 2.2 Model equations 2.2.1 Air and fuel gas flow In natural...
Ngày tải lên: 05/09/2013, 14:58
... to an amplitude histogram, which generates a large inventory of normalized mathematical indexes of abnormality It is the pattern of these mathematical indexes of abnormality, obtained from analysis ... resulting mathematically integrated patterns of the abnormal indexes are then compared for their degree of abnormality to the abnormal index patterns in the reference database to reach a final diagnostic ... in the included trials and were analyzed using the same software and hardware located at the central server location in New York All MCG analyses in this database have been validated against the...
Ngày tải lên: 03/11/2012, 10:58
Analysis on the Optimal Dispatching of Mixed-pump Stations and the Operating-mode Adaptability Based on Safety Water Supply
... binary-encoding will be performed for running status of all pumps and ratios of all variable speed pumps APPLICATION EXAMPLE The method noted above is applied to the optimal operation of a southern ... with the operating-mode adaptability The outlet flow QPi , j of each pump station is taken as the decision variable of the first optimization First of all, coefficiencies α1 , α , α , α of the ... due to low speed ratio of the pump can be avoided through determining the speed range rationally, which plays an important role in the realization and application of optimal operation technology...
Ngày tải lên: 05/09/2013, 09:38
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis
... performance and thermal characteristics of the system Description of the multi-stage evacuated solar desalination system The Multi-stage evacuated solar desalination system is a combination of evaporative-condenser ... convection and radiation is calculated using energy balance equations These heat losses from the flat plate collector are shown in the Figure The detailed thermal analysis of flat plate collector is carried ... latent heat of vaporization of water at the condenser surface of the last stage (J/kg), C pwNs is the specific heat capacity of fresh water in the last stage (J/kg K), TNs is the last stage water...
Ngày tải lên: 05/09/2013, 16:11
the meaning and structure of a narrative a systemic functional analysis
... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... Re-examine some of the most important issues related to the experiential aspect of functional grammar • Analyze the meaning and structure of a narrative based on the systemic functional analysis ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language...
Ngày tải lên: 07/09/2013, 13:48
Reliability analysis of a power system based on the multi state system theory
... indicates that when the capacity of the system is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh ... mAh and the capacity of other branches are all above 5800 mAh, the system is reliable because the required capacity is reached But when we analyze the system reliability using the traditional ... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi-state system theory According to (2), the universal generating function of the battery...
Ngày tải lên: 03/01/2014, 19:38
Tài liệu TRANSIENT and STEADY STATE THERMAL ANALYSIS OF HEATSINK Pro/ENGINEER and Pro/MECHANICA Wildfire doc
... to after 150 seconds This value of is a multiplier for the Q load of 50 Watts 15 A graph of the function can be seen by selecting Review Click the Graph button Create a Transient Thermal Analysis ... sides Make a cut with the dimensions shown below Pattern the cut with increment of 0.004 m and total of 15 cuts Create a cut to accommodate the fan at the top of the heat sink Create another cut ... uniform initial temperature Typically the estimated variation is left set to Auto In this case the user estimates the heat sink will start at 22 C and reach a maximum of about 52 C so a value is input...
Ngày tải lên: 19/01/2014, 05:20
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc
... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ... Subject The spaceship The planet They There The spaceship The two astronauts The woman It She We It Both of them They All plants and Animals They They Everything The man Nothing Something He I The...
Ngày tải lên: 12/02/2014, 20:20
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx
... phonology of languages Universal alphabets Logical relations of the parts of speech The vocabulary and the grammar of languages Distinctions between languages and dialects Mixed languages and jargons ... Eurafrica, Austafrica, Asia, America, Oceanica Causes and consequences of the migrations of races and nations a The Eurafrican Race.—Types of the white race Its first home Early migrations The South ... Subdivisions of Races Theories of monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica,...
Ngày tải lên: 13/02/2014, 05:20
Tài liệu ELECTRICAL /DATA CABLING WORKS IN THE BRANCH OF BANK OF INDIA, BHULLAR , LUDHIANA. doc
... of approved make & shall be as per relevant Indian Standard Specification Where it is mandatory to use I S Marked materials, the contractor shall arrange the same accordingly 32 The contractor ... earmarked for staff with the seating for maximum 20% of staff strength of the Branch depending upon the availability of space in the branch h) In CBS Branches, no serve room is required As the ... set) And Bank of India Zonal Manager Regional Office, Ludhiana 47 Any clarification regarding drawing Please Contact: ARCHITECTS : M/S HERZI SINGH & ASSOCIATES Plot No 2772, Gurdev Nagar, Near...
Ngày tải lên: 16/02/2014, 11:20
Tài liệu INTERIOR/ FURNISHING & RENOVATION WORKS IN THE BRANCH OF BANK OF INDIA, BHULLAR , LUDHIANA ppt
... with RM’S Cabin adjacent Branch Manager’s Cabin The modules having indicative sizes of the Diamond Customer Lounge along with Relationship Manager’s Cabin and Branch Manager’s Cabin and Diamond Customer ... besides the Information Technology Department and Security Department of Zonal Office and Branch Manager as per the requirement of the Branch a) Diamond Customer Lounge / Relationship Manager : In the ... months 17 The schedule of quantities is only approximate & all the work executed shall be paid for in accordance with the actual measurements 18 The samples of all the material & work times shall be...
Ngày tải lên: 16/02/2014, 11:20
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... ẳ DA352 ỵ DA361 ị IF0 DAmax ỵ DAmax Þ 352 361 where, e.g., DA352 corresponds to change of absorbance at wavelength 352 nm in the reaction sample after incubation time t; DAmax ¼ jACNCbl À AH2 ... Preparation of the unsaturated apo-form of IF was although modified Thus, the Cbl-saturated holo-IF (1 mgỈmL)1) was dialysed against 20 volumes of m urea (30 °C) instead of m GdnHCl The incubation ... above facts mean that the intestinal uptake of analogues can be quite feasible In this regard we plan to examine a group of analogues concerning details of their binding to the specific proteins and...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx
... conjugates were independent of the size of the glycan (Tables and 5, [36]) The analysis revealed that the changes in these parameters statistically correlate for both the acylation and deacylation ... mechanism of the enzyme Structural insights into the mechanochemical nature of a- CT catalysis A more detailed analysis of the influence of chemical glycosylation on the dynamics of a- CT from the theoretical ... to the increase in these parameters Analysis of the changes in internal hydrogen bond composition for the protein-glycan conjugates indicates that for all of the conjugates there was also an...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
... amount of PAI-1 required to inhibit half the uPA The half-life of PAI-1 was finally calculated from an exponential decay plot of the data obtained Generally, only one preparation of each PAI-1 variant ... conformation (Fig 2) The rate of latency transition was determined for all variants Typical assays are depicted in Fig 4, and the data for all the variants are summarized in Table Replacing any of the ... with uPA and SDS/PAGE analysis After 24 h, the fraction of molecules behaving as a substrate for uPA decreased approximately twofold for PAI-1(V12 6A) , PAI-1(F10 0A) , PAI-1(F12 8A) and PAI-1(W14 1A) ...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: "An Information-Theory-Based Feature Type Analysis for the Modelling of Statistical Parsing" docx
... information quantity among all of the history feature type candidates That is to say, objective feature types may have larger predictive power than that of the history feature type 5.4 The analysis ... brother of the parent 0.2505 1.5603 0.6145 5.2 The analysis to the influence of the structural relation and the structural distance to the predictive information quantities of the history feature ... that the performance is improved after the lexical information is added Our research aims at a quantitative analysis of the differences among the predictive information quantities provided by the...
Ngày tải lên: 20/02/2014, 18:20
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories The multiracial population of Malaysia ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges...
Ngày tải lên: 06/03/2014, 15:21
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... Monoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB Analysis of mAbs binding to the recombinant FnBR indicated the generation ... secondary antibody was quantified by adding the substrate o-phenylenediamine dihydrochloride and measuring the resulting absorbance at 490 nm in a microplate reader SPR analysis SPR analysis of NTD ... Biorad) was also used to dilute the analyte All of the assays were performed at 25 °C The sensorgrams (time course of the SPR signal in RU) were normalized to a baseline value of All sensorgram...
Ngày tải lên: 06/03/2014, 22:21
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx
... influence the way in which people can access and make use of their assets Natural capital Natural capital is the quality and quantity of natural resources that are available to people and above all, the ... (RRA) approach to initial project preparation was developed By the end of the decade, there was a range of RRA methods and approaches available which then gave rise to participatory rural appraisal ... interviews Rapid market appraisal The origins of rapid market appraisal (RMA) are similar to those of rapid rural appraisal (RRA), in that formal surveys were often seen as lengthy, costly and management...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...
Ngày tải lên: 07/03/2014, 14:20
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... present any activity on thiamin degradation Other enzymes involved in the thiamin pathway A comparative analysis of the thiamin biosynthetic pathway of more than 80 bacterial genomes was performed ... protease aprE, at the transcriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/) A comparative analysis of several fully...
Ngày tải lên: 16/03/2014, 00:20