tips for writing a letter of recommendation for a friend

Báo cáo khoa học: "Implementing a Characterization of Genre for Automatic Genre Identification of Web Pages" pot

Báo cáo khoa học: "Implementing a Characterization of Genre for Automatic Genre Identification of Web Pages" pot

... more dynamic view of a genre classification system. Automatic identification of text types and genres represents a great advantage in many fields because manual annotation is expensive and time-consuming. ... blog_augustine_0000024 704 of being argumentative_persuasive shows a high gradation of argumentation. Gradations/ probabilities are ranked for each web page. The computation of text types as ... ca. 86%. An accuracy of 86% is a good achievement for a first implementation, especially if we consider that the standard Naïve Bayes classifier returns an accuracy of about 67%. Although slightly...

Ngày tải lên: 23/03/2014, 18:20

8 318 0
Example Questions for Writing Task II of IELTS

Example Questions for Writing Task II of IELTS

... doing trials on innocent animals. Give your opinion in not to-face contact for its main means of communication? 34.Zoos are sometimes seen as necessary but not poor alternatives to a natural environment. ... efficiency decreases. Should young people in the working fields replace all the old people? 22. Animals also have emotions and feel equal pain as humans. We should stop all pharmaceutical companies from ... few changes in not less than 250 words. 7.Computers can easily do all the basic and advanced calculations. Do you think your children should spend more time learning basic mathematics or advanced...

Ngày tải lên: 04/10/2012, 10:24

4 1,5K 4
Tài liệu Security Agreement and Pledge For Use with Letter of Credit pptx

Tài liệu Security Agreement and Pledge For Use with Letter of Credit pptx

... that his application is subject to final credit approval and that additional information may be required. By signing below the Applicant agrees that the Bank may place a hold on the Collateral ... XY-ZU-4715 Page 2 of 2 FOR CORPORATIONS ONLY: THE PRESIDENT OR CHAIRMAN OF THE BOARD OR ANY VICE PRESIDENT AND ONE OF THE FOLLOWING, SECRETARY, ASSISTANT SECRETARY, CHIEF FINANCIAL OFFICER OR ASSISTANT ... Franchise Tax Board, at any time, and disclose information given Bank to the Applicant. All owners / authorized signers must sign and include their titles. The Applicant understands and agrees...

Ngày tải lên: 20/12/2013, 17:15

2 663 1
A novel interval method for validating state enclosures of the

A novel interval method for validating state enclosures of the

... parameters is 1 Further information about ValEncIA-IVP as well as free software are available at http://www.valencia-ivp.com. 6 of the error bounds  R (κ+1) (t)  . Note that neither separate ... optimal, and adaptive controllers. For nonlinear systems, robustness analysis with respect to uncertain initial states and parameters can be performed by calculating enclosures of all reachable states. ... RESEARCH In this paper, VALENCIA-IVP has been introduced as a novel approach for validation of state enclosures for initial value problems with both uncertain initial conditions and tolerances...

Ngày tải lên: 12/01/2014, 22:04

12 373 0
Tài liệu A History of England for Boys and Girls pdf

Tài liệu A History of England for Boys and Girls pdf

... horror of war had filled the land for so many CHAPTER 19 47 was really to blame for it. So Aurelius Ambrosius and Uther Pendragon fled away to that part of France called Brittany, where they remained ... equal." Then Arthur was sad no longer. He did as Merlin advised, and had a great round table made, at which there was a seat for each one of his knights. After that there was no more quarreling ... last, weary of fighting, and forsaken by nearly all his followers, Alfred was forced to hide for a time in the marshes of Somerset. This was the saddest part of Alfred's life. He was a king,...

Ngày tải lên: 20/02/2014, 08:20

285 627 0
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf

Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf

... the data and in further projects of similar nature. For example, the ROUGE similarity could be used in the data collection phase as a tool of au- tomatic approval and rejection of workers’ assign- ments. 4 ... several passages of texts has for a long time been a research prob- lem within the field of automatic summarisation. For each document it is possible to create several summarisations that can each be ... minimum of $0.05) service fee per each paid reward. ã Qualications To improve the data quality, a HIT can also be attached to certain tests, “qualifications” that are either system-provided or created...

Ngày tải lên: 20/02/2014, 09:20

9 611 1
Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt

Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt

... pitch, amplitude and pronuncia- tion and users are given immediate feedback on the acceptability of each recording. Users can then rerecord an unacceptable utterance. Recordings are automatically ... feedback on the quality of each utterance they record in terms of pronunciation accuracy, relative uniformity of pitch, and relative uniformity of amplitude. Confe- rence attendees will be able ... by a profes- sional speaker and manually polished, all other voices were created by untrained individuals, most of whom have ALS, in an untrained setting, with the recordings having no manual...

Ngày tải lên: 20/02/2014, 09:20

4 419 0
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

... Edmonton, AB, Canada Type IIa bacteriocins, which are isolated from lactic acid bacteria that are useful for food preservation, are potent antimicrobial peptides with considerable potential as therapeutic ... Engineering Research Council of Canada, the Alberta Heritage Foundation for Medical Research, CanBiocin Ltd (Edmonton, AB), and the Canada Research Chair in Bioorganic and Medicinal Chemistry. References 1. ... University of Alberta) for performing all CD experiments. Albin Otter (Department of Chemistry) and Ryan T. McKay (NANUC, University of Alberta) are gratefully acknowledged for assistance with...

Ngày tải lên: 07/03/2014, 15:20

9 520 0
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

... PCR was performed on an egfp-containing plasmid (a gift from Dr K. Apt, Martek Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5Â-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3Â) and antisense ... (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5Â-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3Â and antisense primer 5Â-GAAT GCGGCCGCTCAGTCCTGCTC CTCGGCCAC-3 ¢, which introduced a NotI restriction ... PCR was performed using Pnr BamHI5.4kb as the template with sense primer 5Â-GAAT GCGGCCGCGA ATGTGTGCAAATTGAAGAAC-3Â and antisense primer 5Â-TTCGAGCTCCGGGGAAACGGTGCCAACTT-3Â,which introduced a NotI...

Ngày tải lên: 07/03/2014, 21:20

11 668 0
Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx

Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx

... All grammar settings and annotations are saved and available the next time the user logs on. Finally on the Data Download page, users may download data so that they can use the patterns and ... Selection and Data Download. First a user has to specify, on the Grammar Selection page, which settings of the 13 parameters are of interest and save those settings as an available grammar. A user ... with all possible syntactic derivations of each pattern. The patterns and their derivations are generated from a large battery of grammars that incorporate many features from the domain of natural...

Ngày tải lên: 08/03/2014, 04:22

8 368 0
Center for Audit Quality Observations on the Evolving Role of the Auditor: A Summary of Stakeholder Discussions doc

Center for Audit Quality Observations on the Evolving Role of the Auditor: A Summary of Stakeholder Discussions doc

... Financial Of cer, Bank of Marin Alison Davis, Chairman, LECG and Member, Board of Directors, City National Bank Paul Dawes, Retired Partner, Latham & Watkins LLP CENTER FOR AUDIT QUALITY ... ROLE OF THE AUDITORA SUMMARY OF STAKEHOLDER DISCUSSIONS 9 (2) For each area: ã Whatlevelofassuranceshouldbeprovidedandwhat is the appropriateformofauditor communication? ã Wouldauditorassociationrequiresignicantadditionalprocedures(separatefromdraftingthe auditors ... regulations and interpretive guidance for MD& ;A disclosure (attorneys and former regulators). t Management is not taking advantage of the safe harbor afforded by SEC regulations for forward-looking...

Ngày tải lên: 15/03/2014, 20:20

20 388 0
The Future of the Internet: A Compendium of European Projects on ICT Research Supported by the EU 7th Framework Programme for RTD ppt

The Future of the Internet: A Compendium of European Projects on ICT Research Supported by the EU 7th Framework Programme for RTD ppt

... package takes care of the overall management of the project’s operational and  nancial aspects and facilitates in- and external cooperation. WP2: Use cases and framework for self-organisation. ... Global standards for a new generation of ubiquitous and extremely high capacity network and service infrastructures (…): o E harmonisation of legacy and new standards for e cient, advanced and ... both a database infrastructure and a tool for real-time measurements. ã LOBSTER: LOBSTER provides a database infrastructure. ã RIPE: RIPE provides a database infrastructure. ã BART: BART is a...

Ngày tải lên: 15/03/2014, 21:20

162 453 0
Báo cáo khoa học: "A Figure of Merit for the Evaluation of Web-Corpus Randomness" ppt

Báo cáo khoa học: "A Figure of Merit for the Evaluation of Web-Corpus Randomness" ppt

... lan- guage, excluding function words, while Ueyama and Baroni (2005) built corpora of Japanese using seed words from a basic Japanese vocabulary list. Both Sharoff and Ueyama and Baroni evaluated the ... through a manual classification of the retrieved pages and by qualitative analysis of the words that are most typical of the Web corpora. We are also interested in evaluating the effect that different ... construct a “balanced” corpus via a search engine one reasonable strategy is to use appro- priately balanced query terms, e.g., using ran- dom terms extracted from an available balanced corpus (Sharoff,...

Ngày tải lên: 17/03/2014, 22:20

8 436 0
A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf

A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf

... This may be illustrated by such words as abdomen, acclimate,appendicitis, candelabrum, data, finance, ignoramus, gratis, etc. There are many words in our language about whose pronunciation ... the English language is the usage that prevails among the best-educated portion of the people to whom the language is vernacular; or, at least, the usage that will be most generally approved by ... Campbell's law of the good usage of a word applies with much force to its pronunciation. This law requires this usage to be, first, reputable, or the practice of intelligent and educated...

Ngày tải lên: 22/03/2014, 16:22

156 470 0
w