... *Here you are : c a anh/chị (c u nói đưa cho người kh c vật gì) *Khi giao tiếp nhớ dùng “please” để tỏ lịch PRACTICE THE DIALOGUE: Work in pair b,Listen and repeat.Then practice the dialogue using ... MATCHING: A 1.A bottle of 2.A dozen 3.A box of 4.A tube of 5.A kilo of 6.A packet of B a, toothpaste b , oranges c, beef d, water e, tea f, chocolate HOMEWORKS: _H c thu c lòng từ vừa h c _H c ... vật chứa khối lượng,trọng lượng ,c c đơn vị đong, đo , đếm với danh từ kh c, ta để từ đơn vị đứng trư c nối danh từ kh c giới từ “of”( trừ trường hợp “a dozen” giới từ “of” kèm) Vd:a bottle of cooking...
Ngày tải lên: 15/06/2015, 09:41
... 5¢-GGTGTAGAATTCAAGAACGAGGAACTGCG-3¢ was combined with (a) 5¢-ATAGTTTAGCGGCCG CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219, (b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ for ... 219HIS, (c) 5¢-ATAGTTTAGCGGCCGCTTACGGCTT CCGGCGGATGATGAGCGAG-3¢ for e1–220, or (d) 5¢ATAGTTTAGCGGCCGCTTAGTGATGGTGATGGTGA TGCGGCTTCCGGCG-GATGATGAGCGAG-3¢ for e1– 220HIS (underlined EcoRI and NotI) ... ATTCCGGAACCAGGAGGAGCGC-3¢ was used in all cases, together with the reverse primer (a) 5¢-ATA GTTTAGCGGCCGCTTACTTGCGCTGGATGATGAG CAGG-3¢ for c1 –218, (b) 5¢-ATAGTTTAGCGGCCGC TTAGTGATGGTGATGGTGATGCTTGCGCTGGATG...
Ngày tải lên: 30/03/2014, 10:20
Báo cáo sinh học: " Macrogeographic patterns in B-chromosome and inversion polymorphisms of the grasshopper" pps
... 107112 Confalonieri VA, Colombo PC (1992) Polimorfismos de inversion y selecci6n natural en Trimerotro!is pallidipennis: correlaci6n variables climaticas Actas XXIII Congreso Argentino de Gen6tica, ... wish to express my sincere thanks to JH Hunziker for critical reading of the manuscript Financial support from the Consejo Nacional de Investigaciones Cientificas y T6cnicas and Universidad de ... (S9-S11) The X-chromosome is metacentric, the large elements are submetacentric (Vaio et al, 1979) while both medium and short chromosomes are basically acrocentric (Confalonieri, 1988) The B-chromosome...
Ngày tải lên: 09/08/2014, 18:21
lei - determinants of cg and the link between cg and performance - evidence from the uk using a corporate governance scorecard
... relevant to corporate governance scorecard here As previously described, the corporate governance scorecard incorporates many governance devices, including board structures, managerial compensation, ... 62.47 57.00 3.74 1.00 Construction 15: Building Construction General Contractors And Operative Builders 16: Heavy Construction Other Than Building Construction Contractors Manufacturing 36 4.3% 58.25 ... firms) SCORE: corporate governance index obtained from the corporate governance disclosure scorecard INSIDE: percentage of beneficial shares held by executive directors and non-executive directors...
Ngày tải lên: 06/01/2015, 19:48
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_1 ppt
... practice, but grounded in science Translate organizational science into practice by generating guidelines, principles, and lessons learned that can shape and guide practice Showcase the application ... in cross-cultural psychology Michele received the Ernest J McCormick Award for Early Career Contributions from the Society for Industrial and Organizational Psychology and the LL Cummings Scholar ... Human Capital practices at PwCC and IBM Consulting The Contributors xxv Pat has a PhD in organizational psychology from the University of South Florida and is a licensed psychologist in Connecticut...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_2 doc
... different time zones can also be difficult Conducting conference calls with an international audience, however, requires the coordination of a space shuttle launch Conference calls scheduled for early ... most successful organizations, a pioneer of new organizational concepts such as Variance Optimization and Employee Confidence He is experienced with manufacturing, financial services, heath care, ... travel costs associated with securing the productive working relationships needed for acquisition success Understanding that reactions to the change will differ widely by local country culture Securing...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_3 doc
... acceptance of the host culture is more practical and realistic than trying to convert the local population In essence, I believe that becoming bicultural, or even polycultural, is key to success ... and the Scandinavian countries, relationships come first 36 Going Global Societal Cynicism Bond and associates (2004) proposed a research-based cultural dimension called ‘‘societal cynicism.’’ ... versus collectivism also reflects some of the important differences between Western and non-Western cultures Economically poor societies are often thought of as collectivist because they are characterized...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_4 pdf
... set cooperative goals and, when conflict 54 Going Global occurs, employ cooperative conflict management strategies (Chen et al., 2006) Critical Process #2: Ensuring Clear and Meaningful Communication ... Teams: Critical Team Processes and Guidelines 51 that researchers have not been conceptually disciplined when it comes to the constructs which are identified as process, often confounding process ... of these critical components Critical Components Driving Effectiveness in Multicultural Teams • Process Components Engaging in leadership—creating and maintaining coherence Ensuring clear and...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_6 doc
... strategic and objective, networks based on social contacts, caste, and other social connections still influence human resource policies and practices Indians, for example, are relatively more collectivist, ... contexts serve as contingencies that influence human resources practices in general and recruitment in particular Key exogenous or external contingency factors include the legal, societal or cultural, ... question may be culture-speci c (for example, criteria and sources of recruitment) (Tayeb, 1995; 1998) This is especially the case because historical legacies, social stratification, educational system,...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_7 potx
... for educational and psychological testing, created by the American Educational Research Association, American Psychological Association, and the National Council on Measurement in Education (Oakland, ... must deal with effectively A more acceptable (to companies) approach in Asia, at least, is the concept of the competency model The use of competency models is becoming more accepted in the region ... predetermined recruitment process that can be used across locations Technological Sophistication The final contingency we discuss in this chapter is the level of organizations’ ever-expanding technological...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_8 ppt
... after work, which is a large obstacle to success in the project Another aspect of culture which may impact selection is level of context According to Hall (1976) cultures run on a continuum between ... aspects such as personality, context may play a key role in how individuals Global Selection 167 Table 6.3 High-Context Versus Low-Context Cultures Issue High-Context Low-Context Cultures (HCC) Cultures ... safety notices, including accident book Utilities, such as lighting, heating, water Access to buildings, security Incoming and outgoing mail points Notice boards Computer system, Internet access,...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_9 doc
... hugely successful practice for creating leaders, who are ‘‘cut from the same cloth.’’ On the surface, this approach to leadership development appears to have been successful The practical value ... multinational is commonplace and in fact highly sought after Back then, however, the world was much less connected It is also a practical reality that while researchers may accumulate knowledge ... practice included a basis in Anglo Saxon model of traits, centralized control, hierarchical, and mechanistic Following the Second World War, the United States played a major role in the world economy,...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_10 ppt
... organization Influence of Colonialism Much of the Arab world has been subject to Western bureaucracy This legacy includes a strict adherence to the chain of command, and adherence to secular systems ... employee confidence reporting that it has declined (see Figure 9.3) Thus, we can conclude that employee perceptions of performance align with the fiscal reality Consumer Confidence It could be logically ... Domestic Product (GDP) A rank order correlation between change in gross domestic product and employee confidence for each of the 12 countries in the sample revealed a significant rho of 87 (replication...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_12 pptx
... practical choice because trainees will only ever be interacting in one speci c culture In this situation, culture-speci c competence training should be focused on the work-related cultural aspects ... much more important to focus on work-related cultural differences, such as preference for electronic or face-to-face communication, or cultural business customs By tailoring the intercultural competence ... Culture and competence: Contexts of life success (pp 89–110) Washington, DC: American Psychological Association Lopez, S R (1997) Cultural competence in psychotherapy: A guide for clinicians and...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_13 potx
... change can be taken from social, clinical, and health psychology and applied to organizational change efforts, and (d) what practical techniques can interject these components to create infectious ... Francisco: Berrett-Koehler TRADOC Culture Center (2009, March) Classes on culture Pamphlet distributed at the 2009 Culture Education and Training Summit Triandis, H C (1994) Culture and social ... prevention policy), then there is a good chance that the communication, no matter how logical, will be disregarded Communication must be combined with other psychological conditions in order to create...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_15 doc
... In C L Cooper & R Payne (Eds.), Current concerns in occupational stress Chichester, UK: Wiley Briscoe, D., & Schuler, R (2004) International human resource management: Policies and practices ... work-family conflict and outcomes (such as job satisfaction) are weaker in more collectivistic societies than in less collectivistic (aka individualist) societies (see Spector et al., 2004; Spector et ... support and social interaction (such as club memberships, housing in an expatriate community, trips home) are helpful These practices can create a sense of belonging, enhance psychological security...
Ngày tải lên: 21/06/2014, 08:20
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_17 docx
... 126, 129 Charan, R., 114 Chatman, J., 126, 129 Check, J A., 177 Chen, C C., 353, 356, 380 Chen, G., 54, 276 Cherrie, C. , 264 Cheung, F., 160 Chi, S. -C. , 353 Chiu, C. , 48 Choi, J., 353, 380 Christensen, ... A., 46, 61 Conyne, R., 47 Cooper, C L., 380 Copeland, L., 256 Corace, C. , 307 Costa, P T., 315, 340 Cox, T H., 47 Crafts, J L., 68 Cramton, C D., 63, 64 Cross, R., 191 Crowne, K A., 261 Cui, G., ... R., 88 Chua, C H., 336 Chua-Eoan, H., 147 Chung, Y., 349 Church, A., 339, 340, 341 Cialdini, R., 318, 319, 321 Ciampa, D., 177 Coffman, C. , 187, 191 Cohn, M A., 247 Colakoglu, S., 363 Colding,...
Ngày tải lên: 21/06/2014, 08:20
Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series_3 doc
... dominates the culture, corporate commissars all the thinking, control access to information, and tell everyone what to Under these circumstances, collaboration is an unnatural act There are two ... process is voice—the power to be heard and to influence outcomes Maximizing voice means widening the circle of involvement to encompass those likely to be affected by the change process, including ... a self-reinforcing circle of commitment, coordination, and employee competency—all bedrocks of effective change.3 Their steps have lost none of their potency over the years since their work was...
Ngày tải lên: 21/06/2014, 08:20