... FSoft has established FPT Software Japan, Ltd with its headquarters in Tokyo and a representative office in Osaka, Japan Following the success of FPT Software Japan, FPT Software APAC was established ... : Japanese levels of proficiency or experience LAN : Local Area Network NASDAQ : National Association of Securities Dealers Automated Quotation System NASSCOM : National Association of Software ... historical legacy that has created a greater awareness of French and English than many East Asian rivals Young Vietnamese with better English communication have already overcome the language barrier...
Ngày tải lên: 27/10/2012, 16:41
... respectful attitudes of Paley and Alvarez towards the value of life are always appreciated, especially in the contemporary age of technology, diseases and social evils, which has caused escalating ... mother had done was apparently a revenge against her and her husband for they had not been able to save their four and a half month baby from infant death For the past few years, Mabel had always ... marriage All of the characters in the story are intellectual: Paul, the protagonist who had got his Ph.D on literature from Havard; Sang, another female main character from Bengali, who graduated...
Ngày tải lên: 07/11/2012, 15:01
Thermal evaluation of a sun tracking solar cooker
... double-glazed solar cooker, Kumar [7] One of the earliest mathematical models to test the thermal performance of a Solar Cooker was presented by Garg et al [8] and Vaishya et al [9] Also, Jubran and Alsaad ... solar cooker, and the parameters that characterize the performance of the solar cooker Evaluation of solar cooker thermal performance using different insulating materials was conducted by Mishra ... and management vol 32 (6): pp 537-541 R S Mishra, S P Prakash, 1984, Evaluation of solar cooker thermal performance using different insulating materials, International Journal of Energy Research...
Ngày tải lên: 05/09/2013, 17:03
Tài liệu Báo cáo khoa học: Thermal unfolding of smooth muscle and nonmuscle tropomyosin a-homodimers with alternatively spliced exons docx
... lack of N-terminal acetylation The sequence for the N-terminal 5¢ forward primer was 5¢-GGAATTCCATATGGCGAGC ATGGACGCCATCAAGAAGAAGATGC-3¢ As smTm uses the same C-terminal exon 9d as Tm 5a and Tm5b, ... final concentration of F-actin was 46 lm F-actin was stabilized by the addition of a 1.5-fold molar excess of phalloidin (Sigma) to obtain a better separation of the thermal transitions of actin-bound ... Northampton, MA) The thermal stability of the proteins was described by the temperature of the maximum of thermal transition (Tm), and calorimetric enthalpy (DHcal) was calculated as the area under...
Ngày tải lên: 19/02/2014, 07:20
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... elementary arguments from the geometry of numbers and linear algebra Acknowledgments The authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of ... Bhargava, The density of discriminants of quartic rings and fields, Ann of Math 162 (2005), 1031–1063 [3] ——— , The density of of discriminants of quintic rings and fields, Ann of Math., to appear ... ) Remark 3.2 (Shape of number field lattices) Lemma 3.1 emphasizes the importance of understanding the shape of number field lattices For clarity, fix attention on totally real number fields of degree...
Ngày tải lên: 06/03/2014, 08:21
Cách sử dụng (Something) is down to (a number of something) pdf
... to half a bag of rice” = “chúng n a bao gạo” Thông thường bạn nói số lượng vật/ đồ vật bị giảm, bạn liệt kê như: Now it’s down to just me, Claire, and Maria - Hiện tôi, Claire Maria Lưu ý sử ... thao “They’re down to teams now” = “giờ có đội” Hoặc nói việc bạn không sở hữu đồ vật mình: We sold the van, so we’re down to two vehicles now - bán xe tải, xe Hoặc đồ ăn: “We’re down to half a ... Với viết Daily English Speaking Lesson này, cho hiểu ro cách sử dụng " is down to " giao tiếp thường ngày Hãy xem thực hành cho ! “We’re down to only people now.” Công ty bạn v a gặp phải chút...
Ngày tải lên: 10/03/2014, 11:20
A study on the translation of technical terms in the interface of common business website and their Vietnamese equivalent
... literal translation, faithful translation, semantic translation, adaptation, free translation, idiomatic translation and communicative translation And basing on the degree of emphasis on the SL and ... in a flattened diagram as below SL Emphasis TL Emphasis Word-for-word translation Adaptation Literal translation Faithful translation Semantic translation Free translation Idiomatic translation ... scholars defined translation as an art / craft: “Translation is a craft consisting in the attempt to replace a written message and/or statement in one language by the same message and/or statement...
Ngày tải lên: 20/03/2014, 01:26
Providing detailed guidelines for implementation of a number of articles of the law on enterprise
... the case of a limited liability company; the chairman of the board of management and the director (general director) in the case of a shareholding company; all partners in the case of a partnership; ... of the converted company in the case of a limited liability company; number of shares and value of shares already sold, and number of shares carrying the right to offer for sale in the case of ... individuals), names and head office addresses (in the case of legal entities), number of ordinary shares and ownership ratio, and date and number of registration as shareholder in the register of shareholders;...
Ngày tải lên: 27/03/2014, 10:15
advances in thermal design of heat exchangers a numerical approach direct-sizing, step-wise rating, and transients
... geometry and availability of appropriate heat-transfer and flowfriction correlations, thermal design can be approached in the same way as for plate-fin exchangers Lamella heat exchangers Flat tube ... heat-transfer and flow-friction data against Reynolds number, and for all temperature-dependent physical parameters At least 50 stations along the length of a contraflow exchanger are desirable ... temperature-dependent physical properties seven simultaneous partial differential equations hot fluid balance of mass balance of linear momentum balance of energy solid wall — balance of energy balance of energy...
Ngày tải lên: 02/04/2014, 15:14
báo cáo sinh học:" Experience with a "social model" of capacity building: the Peoples-uni" ppt
... the use of the social model of capacity building may allow courses to be offered at a low enough cost to benefit a large number of health professionals who Page of (page number not for citation ... countries, mainly in Africa, with the largest numbers from Nigeria, Tanzania and Uganda Seventy-four were male and 43 female; their previous education and current occupation are shown in Table A fee of ... will be charged for the academic transcript, although a similar amount will be charged in future before the start of the course (by means of an automated Page of (page number not for citation purposes)...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo hóa học: " Temperature sensitive influenza A virus genome replication results from low thermal stability of polymerase-cRNA complexes" doc
... polymerase leads to the synthesis of run-off transcripts with the sequence: AGUAGAAACAAGGGUGUUUUUUCCCGGGAAUUCGGAUCCACACCCUGCUUUUG CUand AGCAAAAGCAGGGUGUGUGGAUCCGAAUUCCCGGGUAAAAAACACCCUUGUUUCUACU, ... experiments where a negative polarity CAT segment was introduced, the ratios of cRNA to mRNA and vRNA to mRNA changed by around fold across the temperature range When a cRNA-like CAT RNA was transfected ... Increased degradation rates of RNPs may explain the apparently greater thermal sensitivity of recombinant RNPs (Figs and 8) because of the much longer timeframe of these assays (3 days compared...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Improvement on thermal performance of a diskshaped miniature heat pipe with nanofluid" docx
... and the average diameter of a carbon nanoparticle was approximately 68 nm For convenience, the mixture of multiwall carbon nanotubes and carbon nanoballs in the base fluid was still called carbon ... the same process The thermal resistances were averaged for all heat loads to be an averaged thermal resistance (Rav) at each charge volume The room temperature was kept at 20°C, and the measured ... Hommer MB, Natan MJ: Preparation and characterization of Au colloid monolayers Anal Chem 1995, 67:735-743 13 Cengel YA: Heat Transfer: A Practical Approach McGraw Hill: Singapore; 2003 14 Tsai CY,...
Ngày tải lên: 20/06/2014, 22:20
báo cáo hóa học: " Correction: Experimental and theoretical studies of nanofluid thermal conductivity enhancement: a review" potx
Ngày tải lên: 21/06/2014, 02:20
Báo cáo hóa học: " Preparation and thermal conductivity of CuO nanofluid via a wet chemical method" potx
... fraction at 25°C The thermal conductivity of the base fluid (H2O) was measured, and it had an average value of 0.580 W·m -1 ·K -1 It can be seen that the thermal conductivity ratio increases as ... in a horizontal tube Int J Heat Mass Transfer 2007, 50:4749-4753 Wu SY, Zhu SY, Zhang XR, Huang J: Preparation and melting/freezing characteristics of Cu/Paraffin nanofluid as phase-change material ... thermal conductivity ratio of the typical sample, defined as k/k0, where k and k0 are the thermal conductivities of the nanofluids and the base media (H2O) respectively, as a function of the particle...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Research Article Algorithms of Common Solutions to Generalized Mixed Equilibrium Problems and a System of Quasivariational Inclusions for Two Difference Nonlinear Operators in Banach Spaces" pdf
... 2009 27 Y Yao, M Aslam Noor, K Inayat Noor, Y.-C Liou, and H Yaqoob, “Modified extragradient methods for a system of variational inequalities in Banach spaces,” Acta Applicandae Mathematicae, vol ... integrals,” Journal of Mathematical Analysis and Applications, vol 305, no 1, pp 227–239, 2005 39 S Reich, “Asymptotic behavior of contractions in Banach spaces,” Journal of Mathematical Analysis and ... resolvents of accretive operators in Banach spaces,” Journal of Mathematical Analysis and Applications, vol 75, no 1, pp 287–292, 1980 30 P Katchang and P Kumam, “An iterative algorithm for finding a common...
Ngày tải lên: 21/06/2014, 07:20
báo cáo hóa học:" Graphical Approximation of Common Solutions to Generalized Nonlinear Relaxed Cocoercive Operator Equation Systems with (A,eta)-accretive Mappings" doc
... quasi-variational inclusions, generalized (random) quasi- variational inclusions, quasi-variational inequalities, and implicit quasi-variational inequalities as special cases of the Equation (1.1) ... variational inclusions involving (A, η)-maximal relaxed monotone and relative (A, η)-maximal monotone mappings in Hilbert spaces and proved its approximation solvability based on the variational graphical ... variational inequality problems and fixed point problems for Lipschitz mappings in Hilbert spaces, and Agarwal and Verma [2] introduced and studied a new system of nonlinear (set-valued) variational...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " Research Article Approximation of Common Fixed Points of a Countable Family of Relatively Nonexpansive Mappings" docx
... Yokohama, Japan, 2000 W Takahashi, Nonlinear Functional Analysis, Fixed Point Theory and Its Application, Yokohama Publishers, Yokohama, Japan, 2000 I Cioranescu, Geometry of Banach Spaces, Duality ... problem of finding a fixed point of a certain mapping or a common fixed point of a family of mappings This paper deals with a class of nonlinear mappings, so-called relatively nonexpansive mappings ... in Pure and Applied Mathematics, pp 15–50, Marcel Dekker, New York, NY, USA, 1996 W Takahashi, Convex Analysis and Approximation Fixed points, vol of Mathematical Analysis Series, Yokohama Publishers,...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: "Research Article Strong Convergence Theorems of Common Fixed Points for a Family of Quasi-φ-Nonexpansive Mappings" ppt
... the Australian Mathematical Society, vol 65, no 1, pp 109–113, 2002 Y Kimura and W Takahashi, “On a hybrid method for a family of relatively nonexpansive mappings in a Banach space,” Journal of ... hybrid algorithm for a family of quasi-φ-asymptotically nonexpansive mappings,” Journal of Computational and Applied Mathematics, in press 25 Y I Alber, “Metric and generalized projection operators ... in Banach spaces: properties and applications,” in Theory and Applications of Nonlinear Operators of Accretive and Monotone Type, A G Kartsatos, Ed., vol 178 of Lecture Notes in Pure and Applied...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " Silver Nanoparticles and Graphitic Carbon Through Thermal Decomposition of a Silver/Acetylenedicarboxylic Salt" ppt
... appearance of turbostratic graphitic layers at the Ag/pyr sample and a minor fraction of quasicrystalline cubic silver phase in the Ag/sol (Figs 4, 5) Quasicrystals emerged in the field of materials ... Zeng, X Jiang, A Yu, G Lu, Nanotechnology 18, 35708 (2007) S Navaladian, B Viswanathan, R.P Viswanath, T.K Varadarajan, Nanoscale Res Lett 2, 44 (2007) 10 A Panacek, L Kvitek, R Prucek, M Kolar, R ... residual carboxylates) and carbon double bonds (e.g., from partially unsaturated rings within graphene layers) Similarly, the FT-IR spectrum of Fig Raman spectra of samples a Ag/pyr, b Ag/sol wavenumber...
Ngày tải lên: 22/06/2014, 00:20