... clean and streamlined The Promise of Casual Games Finally, this book will be about the promise and potential of casual game design Casual games radically changed the landscape of games Now anyone ... gameplay Each game within a genre must add some new challenge to the gameplay or risk being dismissed as too easy by fans of the genre At a fundamental level, games are about learning and mastery ... up and play when you are bored Since Windows Solitaire, casual games have served as salves against boredom Initially, the game isn’t really a focus Only the most elegant and addictive casual games...
Ngày tải lên: 16/03/2014, 21:27
... began to shift his ambitions away from his own unsatisfying career and onto his children—perhaps, in part, because his career had already hit a ceiling: he was vice-kapellmeister (assistant music ... E-string side—thereby allowing for a freer wrist action As a court composer, Leopold Mozart was an ordinary creature of his place and era As a music teacher, though, he was centuries ahead of his ... changes in the brain are arguably the most profound, with a vast increase in precise task knowledge, a shift from conscious analysis to intuitive thinking (saving time and energy), and elaborate...
Ngày tải lên: 27/07/2014, 14:02
A cross cultural study of using hedges in refusing a request in english and vietnamese
... fierce as a lion As fierce as a tiger As slippery as an eel As slow as a tortoise As slow as a snail As stink as a polecat As thick as ants As wet as a drowned rat Like water off a duck’s back To ... the image of a cat appears to our mind Thus, this realization is called lexical meaning On the other hand, grammatical meaning is united word with different lexical meaning It is the meaning recurrent ... students’ awareness of idioms so that they can develop a habit of noticing idioms in everyday situations, including reading and listening Teachers lead a discussion about figurative language including...
Ngày tải lên: 14/12/2013, 00:41
A study on differences of using pasive voi in english and vietnamese = nghiên cứu về sự khác nhau trong cách dùng câu bị động của tiếng anh và tiếng việt luận văn tốt nghiệp đại học
... active voice Eg: The ball was thrown by the boy 1.2 Characteristics of passive voice Characteristically, English is a typical inflectional language, in which there are various inflectional variants ... A recommendation for approval or rejection is made to the Australian and New Zealand Food Standards Council (consisting of the Health Ministers of Australia and New Zealand) should not be translated ... has become an ultimate issue However, the learning of English in our country is not always satisfactory, Vietnamese learners, competent in grammar and vocabulary as they are, still make mistakes...
Ngày tải lên: 18/12/2013, 10:03
Tài liệu Báo cáo khoa học: "TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" ppt
... where sy is a string in a, or f = v and e E a The functional uncertainty approach may be characterized as a localization of the long distance dependencies; a localization at the level of fstructures ... remarks as to the linguistic significance of restricting the use of regular sets in the functional uncertainty machinery by showing that the linguistic theory instantiated in TAG can predict that ... F = a/ .Zl(/)v/ Using the definition of/ ~1 above, and making some reductions we have F = Af.F(comp : f ) V f This is exactly the same analysis as in LFG using the functional uncertainty machinery...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain SUT2 as ... yeast/info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively ... TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGTAC GC-3¢, respectively The plasmid pFL38-RAS2 was constructed by ligating the kb HindIII/EcoRI-RAS2 fragment from plasmid YCplac22-RAS2...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
... either a ballistic or a ramp pinch task, an increase in force and acceleration, associated with an increase in MEP amplitude, was observed in the muscle involved in the training, but not in a muscle ... training While there is evidence indicating that behaviorally driven functional plasticity is a characteristic feature of motor cortex, and that motor behaviour associated with skill learning is ... relating to agonist-antagonist muscle pairs A single suprathreshold pulse of Transcranial Magnetic Stimulation (TMS) over the hand area of M1 results in a balance of inhibitory and excitatory processes...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Triple-Nucleoside Analog Antiretroviral Therapy: Is There Still a Role in Clinical Practice? A Review" docx
... ITT analysis) These data again show that a tNRTI regimen that contains a thymidine analog with 3TC and ABC has virologic efficacy comparable to that of a PIbased regimen, but inferior to that of ... Regimens as Initial ART Clinical trials that have investigated the use of TDF as part of the NRTI backbone of an ART regimen among treatment-naive patients have shown this agent to be highly potent and ... Staszewski S, Keiser P, Montaner J, et al.: Abacavir-lamivudinezidovudine vs indinavir-lamivudine-zidovudine in antiretroviral-naive HIV-infected adults: A randomized equivalence trial JAMA 2001,...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo y học: "Uric acid is a strong independent predictor of renal dysfunction in patients with rheumatoid arthritis" docx
... participated in data acquisition VP participated in data acquisition, provided technical assistance and assisted in analysis and interpretation of data TT, HJ and IA participated in data acquisition ... statistical analysis and assisted in manuscript preparation KMJD and RK participated in data acquisition and assisted in manuscript preparation GDK conceived the idea of the study and Available ... local population (data on file) Insulin resistance was evaluated from fasting glucose and insulin using the Homeostasis Model Assessment of Insulin Resistance (HOMA IR) [30] and the Quantitative...
Ngày tải lên: 09/08/2014, 14:22
Tài liệu The Color Line A Brief in Behalf of the Unborn pptx
... Pyramids and of the Parthenon the radiant names of Hammurabi and Zarathustra and Moses and the Buddha and Mohammed, of Homer and Plato and Phidias and Socrates and Pindar and Pythagoras, and the ... eminent anthropologist, while denying everything as a whole, affirms everything in detail that is maintained in the preceding chapters Inasmuch as the Address of this savant may be regarded as ... negro is equal to the Caucasian He is as tall and as strong He has all the physical basis and all the brain capacity necessary for the development of intellectual power No evidence has yet been adduced...
Ngày tải lên: 19/02/2014, 11:20
Mobil 1 is original equipment in some of the world’s finest vehicles, including potx
... in the landing gear, leading to bearing failure ExxonMobil devised a way of synthesizing grease that retained its lubricating characteristics over a wider range of temperatures than was possible ... that new engines need break -in periods using conventional motor oil? That is a myth In the past, engine break -in was necessary to remove any metal flashing or any other abrasive material left inside ... Porsche Cayenne Transsyberia Team Manager NASCAR “Mobil is the only motor oil I’ll trust in my race engine and in my own car.” – Sam Hornish Jr., NASCAR race driver GM Racing “Mobil has always been...
Ngày tải lên: 08/03/2014, 19:20
There is a Reaper ... pptx
... marveled that so small a portion of a facial anatomy could express such horror "There is something coming toward me," he said "A beast of brutish foulness! Beast is too inadequate a term to describe ... the narrator establishes mind contact with an inhabitant of another, forgotten, Redoubt, and sets off into the darkness to find her J B Woodley With a Vengeance Keep this in mind in teaching apprentices: ... up and stands at my other side We all three wait, myself with a dark fear of this dismal universe, my unnatural companions with patient, malicious menace "Bits of … " He faltered "Of … I can name...
Ngày tải lên: 15/03/2014, 17:20
Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt
... independently of the transketolase reaction [19] Weak acid stress in yeast is acting in a fundamentally different way It is not generating an auxotrophy for aromatic amino acids in wild-type cells, but rather ... encoding a plasma membrane transporter of the major facilitator superfamily, is required for adaptation to acetic acid and resistance to azoles in Saccharomyces cerevisiae Yeast 16, 1469–1481 Wach, ... Loss of Cmk1 Ca2+/calmodulin-dependent protein kinase in yeast results in constitutive weak organic acid resistance, associated with a posttranscriptional activation of the Pdr12 ATP-binding cassette...
Ngày tải lên: 23/03/2014, 21:20
There is a Reaper ... docx
... he said "The realities I knew no longer exist, and I am damp and cold All about me is a sense of gloom and dejection It is an apprehension—an emanation—so deep and real as to be almost a tangible ... widening and now the walls have receded into invisibility The tunnel has become a plain, but the plain is as desolate, as forlorn and dreary as was the tunnel, and still I stand and wait How long must ... me That need to wait is an innate part of my being and I have no thought of questioning it." His voice died again "What are you waiting for?" I asked "I not know," he said, his voice dreary with...
Ngày tải lên: 29/03/2014, 00:20
Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt
... Philadelphia, PA, USA) for target preparation and hybridization to murine MG_U74Av2 GeneChips (Affymetrix, Santa Clara, CA, USA), followed by microarray analysis as described elsewhere [51] Microarray Analysis ... alpha, GATA-4, and caudal related homeodomain protein Cdx2 interact functionally to modulate intestinal gene transcription Implication for the developmental regulation of the sucrase–isomaltase ... PLZF affinity-purified goat polyclonal antibody (EMD Biosciences, San Diego, CA, USA) and actin affinity-purified goat polyclonal antibody (Santa Cruz Biotechnology) RNA analysis Total RNA was isolated...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo y học: "Synovial fluid level of aggrecan ARGS fragments is a more sensitive marker of joint disease than glycosaminoglycan or aggrecan levels: a cross-sectional study" pps
... of joint disease than previously used aggrecan or sGAG assays Materials and methods Amino acid numbering All amino acid numbering of aggrecan is herein based on fulllength human aggrecan, accession ... levels of ARGS Based solely on data available in this paper, the elevated SF levels of ARGS in disease, particularly in the acute inflammatory arthritis and acute injury samples, could be explained ... Conclusions Our findings confirm that aggrecanase cleavage at the 392Glu393Ala bond in the IGD of aggrecan is enhanced in joint pathology, most markedly in acute inflammatory arthritis and early after...
Ngày tải lên: 09/08/2014, 14:21
báo cáo khoa học: " Review of "The Globalisation Of Addiction: A Study In Poverty Of The Spirit" by Bruce K. Alexander Harry G Levine" pot
... one, offering a variety of options that can help addicted individuals find social integration and therefore happier lives Finally, Alexander insists that the rapidly-expanding, modern, free-market, ... global capitalist system is a kind of super hothouse for the creation of every sort of dislocation, and therefore inevitably of all kinds of addiction He stresses the disruptive, dislocating and ... Alexander has more to say: he argues that addiction is an adaptation to dislocation It is a functional way of responding to and dealing with dislocation It is even a creative response that, for a while,...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo y học: "Road trips and resources: there is a better way" pot
... intrahospital transport Using the statistical package Crunch (Verion 4, Crunch Software, Oakland, California, USA), the three groups were analyzed for differences using a one-way analysis of variance (ANOVA) ... overall the CarePorter made the transport easier Since intrahospital transport is a source of angst among staff, anything that can reasonably improve this process is warranted Since all patients were ... unit This increase in workload of the remaining staff nurses may lead to increased stress [7] The issue of care of the remaining ICU patients is critical Unless a qualified outside team transports...
Ngày tải lên: 12/08/2014, 18:20