0

the use of spreading codes in a cdma system 111

introduction to wireless local loop

introduction to wireless local loop

Kĩ thuật Viễn thông

... computer data transfer 3.1.2 ISDN Integrated Service Digital Network (ISDN) basically is a framing format that allows data to be carried at a range of data rates across a bearer ISDN makes use of the ... audio broadcasting and digital terrestrial TV broadcasting For a detailed discussion of this approach, see [1] This approach has the advantage that each transmitted data stream is narrowband and does ... marks have been appropriately capitalized Artech House cannot attest to the accuracy of this information Use of a term in this book should not be regarded as affecting the validity of any trademark...
  • 324
  • 623
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Báo cáo khoa học

... GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG...
  • 16
  • 646
  • 0
Comparison of composition (nutrients and other substances) of organically and conventionally produced foodstuffs: a systematic review of the available literature doc

Comparison of composition (nutrients and other substances) of organically and conventionally produced foodstuffs: a systematic review of the available literature doc

Hóa học - Dầu khí

... Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable ... Amino acids Carbohydrates Total amino acids, total essential amino acids, alanine, β-alanine, arginine, asparagine, aspartate, aspartic acid, cysteine, cystine, glutamate, glutamine, glutamic acid, ... 2005 Authentication paper Authentication paper Authentication paper Authentication paper Authentication paper Authentication paper Authentication paper Authentication paper (comparing isotopes) Authentication...
  • 209
  • 726
  • 0
báo cáo hóa học:

báo cáo hóa học: " Work and diet-related risk factors of cardiovascular diseases: comparison of two occupational groups" doc

Hóa học - Dầu khí

... groups A higher percentage of LA as well as AA were revealed in RBCM of office workers Increased levels are caused by a higher intake of fatty acids in food or by the conversion of LA to AA In a normal ... between the investigated groups In the chef group, significantly increased concentrations of parameters associated with higher intake of meat and animal fats and a lower intake of vegetable and fruits ... Hence, they ingest fewer vitamins and minerals (e g vitamin A, iron and calcium) while their intake of fat, SFAs as well as carbohydrates, especially simple sugars are considerably higher All these...
  • 8
  • 448
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "The survey of some factors affecting bark lesion development caused by Phytophthora cactorum on common beech and other broadleaved trees" pdf

Báo cáo khoa học

... Statistical evaluation was done by means of the statistical package STATISTICA 8.0 (StatSoft Inc.) The variability in measured data was too high, so we transformed them by common logarithm Then ... however the share of maximal and minimal standard deviations (SD) in length of lesions in particular groups of plants was relatively low (max SDi/min SDi < 3) and enabled the processing of the first ... was inoculated and waterlogged and put in trays The stable water level in containers was kept ca cm above the bottoms The experiment was carried out in September The application of the identical...
  • 8
  • 356
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Primary structure of mature SAG1 gene of an Indonesian Toxoplasma gondii and comparison with other strains" pps

Báo cáo khoa học

... ctg V acg A cta I cga S aca T ctc L agg G ggg G aca T gca T tta I caa N aag E taa N cag D acc P tag D tca T gcg A cta I acg A cgt C ccg A tag D cag D gcg A taa N cag D ttg V aag E tgg G aca T gtg ... G aaa K gct S cta I aaa K cat Y tca T gga R tga S gaa K ggt W cga S gag E tta I acg A agg G gca T acc P gac Q ccc P acg A gac Q gag E ggt W tga S aca T ttc L act S ggg G atc L gtt L taa N agg ... V cat Y tgt C aca T cac H ttt F gcc P gca T gtg V acg A gtg V gca T tcg A tcg A gcg A tcg A agg G tac H acg A caa N gca T ctc L tgg G aca T aca T tct S gaa K ttc L acg A gcg A gaa K aag E gag...
  • 8
  • 258
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Estimation of the biomass stock of trees in Sweden: comparison of biomass equations and age-dependent biomass expansion factors" ppsx

Báo cáo khoa học

... quantify and reduce the uncertainties involved in BEFs by developing uncertainty estimation and by taking into account the variation in the allometry of trees Since allometry varies according ... total stem volume in age-class i, and rbef,i is relative standard error of the BEF in age-class i Thereafter, the relative standard error of the overall biomass estimate of trees was calculated ... Scots pine The uncertainty in the biomass estimates of birch was high, since the number of birch stands was low in both the material used for formulation of the BEFs, and in the Swedish data on...
  • 7
  • 314
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A comparison of daily representations of canopy conductance based on two conditional timeaveraging methods and the dependence of daily conductance on environmental factors" ppsx

Báo cáo khoa học

... Seasonal patterns in G are strongly C,day affected by phenological and physical factors In temperate forests, a general pat- of increased canopy conductance accompanies the increase in leaf area ... moreover, many climatological data are available only at the daily scale [47] However, an appropriate daily representation of canopy conductance lacks consensus (e.g compare the approaches in Tattori ... of the rain event diurnally, as daytime rain may lead to a relatively larger apparent G while C,diu nighttime rain may lead to a relatively vallarger G In general, the C,day ues (figure 7) are...
  • 19
  • 315
  • 0
báo cáo khoa học:

báo cáo khoa học: "A comparison of policy and direct practice stakeholder perceptions of factors affecting evidence-based practice implementation using concept mapping" doc

Báo cáo khoa học

... on the cluster rating map, are actually a double averaging, representing the average of the mean participant ratings for each statement across all statements in each cluster, so that one value ... entered into the Concept Systems software [39], which places the data into a square symmetric similarity matrix [40] A similarity matrix is created by arranging each participant’s card sort data in ... piles as the participant deemed appropriate Finally, each participant was asked to rate each statement describing what influences the acceptance and use of EBPs in publicly funded mental health...
  • 12
  • 297
  • 0
Báo cáo y học:

Báo cáo y học: "A three-country comparison of psychotropic medication prevalence in youth"

Y học thưởng thức

... Denmark, and the Netherlands, as well as in the US Drug subclasses that have increased the most have been the selective serotonin reuptake inhibitor (SSRI) antidepressants and the atypical antipsychotics ... Anticonvulsant-mood stabilizers (ATC-MS) included carbamazepine, divalproex/valproic acid, lamotrigine, gabapentin and topiramate Cross-national comparisons of any psychotropic medication use presents a ... enrolled in selected large health insurance systems in the Netherlands, Germany and the US were examined for the year 2000 Claims records were organized with patient as the unit of analysis and duplicate...
  • 8
  • 488
  • 1
Báo cáo y học:

Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"

Y học thưởng thức

... http://www.medsci.org Int J Med Sci 2011, 432 Casaoa MA, Navarroa E, Solerab J Evaluation of Brucellacapt for the diagnosis of human brucellosis Journal of Infection 2004; 49: 102–108 Clavijo E, Diaz R, Anguita A, ... Orduna et al found that since the brucellacapt could determine all three of the antibodies and blocking antibodies that form against brucella, the titers that it has determined were higher in number ... one another was investigated statistically In a comparative study conducted by Prado et al (6), immuncapture agglutination test (Brucellacapt), SAT and Coombs anti-Brucella test were compared...
  • 5
  • 604
  • 0
current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

Quản trị kinh doanh

... because of the increasing application of information technology in business, manufacturing and many other sectors Among them, the software outsourcing stands out as one of the most profitable and ... headquarters in Tokyo and a representative office in Osaka, Japan Following the success of FPT Software Japan, FPT Software APAC was established in January 2007, with its head office in Singapore ... because of many advantages, and could become a major software outsourcing destination in the world with annual average growth of around 40% in the past years In terms of the Knowledge Index and...
  • 79
  • 611
  • 6
Báo cáo y học:

Báo cáo y học: "Comparison of osteogenic potentials of human rat BMP4 and BMP6 gene therapy using [E1-] and [E1-,E2b-] adenoviral vectors"

Y học thưởng thức

... thigh and an injection of ADhBMP4 in the other Each injection contained × 1010 particles The SD rats were separated into four groups (5 animals in each group) These animals received bilateral injections ... group) Animals in the first group received an injection of ADrBMP4 in one thigh and an injection of ADNULL in the other Animals in the other group received an injection of [E1-,E2b]ADGFP&hBMP4 in ... and xylazine, and in each animal the thigh was prepared in a sterile fashion Using a 19-gauge guide needle, the skin cm above the knee joint was punctured and the needle advanced cm proximally...
  • 9
  • 501
  • 0
Báo cáo y học:

Báo cáo y học: "Postoperative pain scores and analgesic requirements after thyroid surgery: Comparison of three intraoperative opioid regimens"

Y học thưởng thức

... necessary only in 1/3 of patients after sufentanil and fentanyl based analgesia while almost always necessary in case of remifentanil based analgesia The necessity of anticipation of postoperative ... No patient had heavy sedation in either of the groups The incidence of nausea and vomiting was not different between groups 12 Table Intraoperative anesthetic and surgical characteristics, Pain ... postoperative pain scores of 30 mm and a standard deviation of 15, with a power of 0.8, a P value of 0.05 was considered to be significant Data were analyzed using Jandel Sigmastat statistical software...
  • 3
  • 516
  • 1
Báo cáo y học:

Báo cáo y học: "Comparison of Classical and Clozapine Treatment on Schizophrenia Using Positive and Negative Syndrome Scale of Schizophrenia (PANSS) and SPECT Imaging"

Y học thưởng thức

... number of hypo/hyper-intense areas in different brain regions Brain regions Superior Frontal* Inferior Frontal Temporal Posterior parietal Anterior parietal* Caudate* Thalamus/basal ganglia Clozapine ... (Iodoamphetamine) Fewer data are available from rCBF studies in schizophrenia by 99mTc-ECD [23] In general, ECD has several favourable characteristics: A Chemical stability lasting several hours after ... minutes after the administration of 99mTc-ECD, each subject was given sedation in the amount of 10 mg Diazepam to decrease motion during scanning Ten minutes after injection of Diazepam, SPECT scans...
  • 8
  • 430
  • 0
 Báo cáo y học:

Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

Y học thưởng thức

... 2009, analyses included in the database were performed using the same “made in USA” equipment as in the included trials and were analyzed using the same software and hardware located at the central ... million deaths annually worldwide and is also an increasing cause of concern in the developing world [2] In the USA alone the prevalence of CAD is estimated at 5.9% of all Caucasians of age 18 and ... location in New York All MCG analyses in this database have been validated against the final medical and angiographic diagnoses, confirmed by two independent academic angiographers having access...
  • 13
  • 684
  • 0
Teaching English to speakers of other language

Teaching English to speakers of other language

Tiếng anh

... a good proportion of ‘authentic’ texts Build up a context Give a learners a reason for reading Use questions carefully Use reading as an input to other tasks Talk about good reading habits Talk ... in related sets Vary your explanation techniques Teach the grammar of vocabulary items Encourage awareness of collocations Spend some time on connotative meaning Help learners to be aware of register ... speaking needs Give some practice at long turns Link speaking to other tasks Correct spoken language selectively Create an atmosphere of acceptance Teaching Writing             Ask learners...
  • 8
  • 354
  • 0
Comparison of Methods for the Extraction of Bioflocculants from Activated Sludge

Comparison of Methods for the Extraction of Bioflocculants from Activated Sludge

Môi trường

... The kaolin clay was treated with ethylenediaminetetra-acetate (EDTA) to prevent the influence of contaminating cations Kaolin clay was suspended in 40 mM EDTA and stirred mechanically for h at ... corresponded to that of the UV-absorbing peak In this case, the UV-absorbing peak was mainly protein These results agreed well with analytical data of the polymer components shown in Table Conclusions ... respectively); in contrast, the steaming-extracted polymer included a larger amount of saccharides (24.6%) compared to the other methods The SDS-extracted polymer included a small amount of material other...
  • 11
  • 695
  • 1
Application and Comparison of Two Biotic Ligand Models Predicting Copper Toxicity and Accumulation in Heavy Metal Tolerant Moss

Application and Comparison of Two Biotic Ligand Models Predicting Copper Toxicity and Accumulation in Heavy Metal Tolerant Moss

Môi trường

... after the exposure The moss was incubated for days, and then the photograph of the moss was taken again All incubations were performed under aseptic condition The area covered by the moss was measured ... by an image analysis Only the saturated portion of the photograph was extracted and the brightness was adjusted using a commercial image analysis software (SimpleVmpViewer) The transformed image ... metal internalization flux non-competitively by binding to a binding site other than BL In addition, changes in the conformation of BL caused by this binding of proton result in decreases in the...
  • 7
  • 432
  • 0
Comparison of Two Synthesis Routes to Obtain Gold Nanoparticlesin Polyimide

Comparison of Two Synthesis Routes to Obtain Gold Nanoparticlesin Polyimide

Năng lượng

... was used to illuminate the membrane The laser intensity was measured as the laser power divided by the illuminated surface, also calculating the minor loss of intensity in the laser pathway The ... filtration, a membrane was mounted in the cell and sealed off with a Viton O-ring In some filtrations, a sealing flat plate was used to reduce the active membrane surface to equal the illuminated ... example, by use of optical fibers incorporated into the membrane support In Figure 13, the new data are combined with the previously obtained data.26,27 The added dashed line indicates the 1:1 data, where...
  • 11
  • 451
  • 0

Xem thêm