the theory basis of business strategy of a company

... determining features of the latter The less use made of comparative systematization, the more use must be made of the particular systematization of the target language In translation as in any other linguistic ... class equivalences The autonomy thus acquired by the lexis of the target language allows the thesaurus stage of the dictionary to be the same for one target language whatever the source language, ... and A. F ParkerRhodes The lattice program, which is a mathematical generalization of a comparative grammar (i.e a non-linguistic abstraction from the description of a finite number of languages...

Ngày tải lên: 23/03/2014, 13:20

... with A and B genome [3] Several studies aimed at identifying the wild diploid ancestors of A hypogaea The wild species A duranensis and A ipaënsis appeared to be the best candidates for the A and ... diploid AA and A ipaënsis KG30076 diploid BB), a tetraploid AABB amphidiploid (A ipặnsis × A duranensis)4X, hereafter called AiAd and a cultivated tetraploid AABB variety (Fleur 11), was used ... the genome-wide analysis of the transmission of chromatin between wild and cultivated species of the genus Arachis However, the wild parents used to create the amphidiploid (A batizocoi, A cardenasii...

Ngày tải lên: 12/08/2014, 03:21

... competitive a vantages Strengths & Weakness Functional Strategy Competitive Strategy Corporate Strategy Global Strategy Matching organization structure to chosen strategy 1r Implementation and Adjustment ... 1.2 The ĩeatures and roles of strategies It c a n b e s e e n th a t t h e c o n c e p ts o f a s tr a te g y a r e v a r ie d Y e t, a s tr a te g y , f r o m a n y a n g l e s a n d a t a n ... in g r e a t d i f f e r e n c e f r o m t h e i r t r a d i t i o n a l s t r a t e g i c a n a l y s i s a n d a p p ro a c h e s CHAPTER THEORY ON FORMULATING BUSINESS STRATEGY Strategy defínition...

Ngày tải lên: 26/03/2015, 08:48

... of human morbidity and mortality, age-associated degenerative changes in the cardiovascular system are probably most critical, for the obvious reason that all of the other cells of the body are ... combinations And in a very real sense, 30 THE NATURE OF CELLULAR S E N E S C E N C E AND DEATH the death of the macronucleus in paramecia predicts our own corporeal deaths Paramecia had created macronuclei ... disease, heart attack, cancer, or other age-related disorders W h e n talking about the basic biology of aging, as opposed to its A M E A N S TO AN E N D outward physical and behavioral manifestations,...

Ngày tải lên: 11/06/2014, 05:26

... hA = G}, if A is a basis for G, ∞, otherwise (1.2) In the case where ρ (A) < ∞, this invariant is usually referred to as the order1 of the basis A Now let us specialise to the case G = Zn , a ... for bases consisting of at most elements Proof Let n ∈ N and A be a basis for Zn such that |A| If |A| = then n = 1, so the Theorem is vacuous If |A| = then ρn (A) = n − 1, as already noted in the ... n) and argue as before This completes the proof of the lemma for bases {0, 1, t} Now let us deal with the general case of a 3-element basis A = {0, a, b} Again, fix k ∈ N, let n be very large and...

Ngày tải lên: 08/08/2014, 12:22

... transplantation in autoimmune diseases are the subjects of the article by Hügle and van Laar [5] They review the available evidence of this intensive therapy – traditionally, a salvage therapy for nonresponders ... involvement of the vasculature in inflammatory rheumatic diseases, including the role of the vasculature in atherosclerosis and increased cardiovascular risk, leading to increased mortality The cellular ... immunological and nonimmunological basis of disease and the implications for future treatment options The Scientific Basis of Rheumatology: A Decade of Progress should provide the reader with an easily...

Ngày tải lên: 09/08/2014, 13:22

... GWAS in the Singapore Chinese, Malays and Asian-Indians A metaanalysis of similar studies in other East Asian populations was performed in order to clarify the importance and relevance of these ... that patients with T2DM were more likely to have a diabetic mother than a diabetic father, suggesting that the excess maternal transmission observed in Caucasian populations may apply in Asian ... Commercially available genotyping arrays by Illumina® (San Diego, California, USA) and Affymetrix® (Santa Clara, California, USA) enable researchers to genotype up to one million SNPs per sample These...

Ngày tải lên: 14/09/2015, 08:48

... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...

Ngày tải lên: 24/12/2013, 01:17

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... concentrations indicated on each curve of K12 8A mutant GAPDH, K128E mutant GAPDH, R19 7A mutant GAPDH, and R197E mutant GAPDH In all plots, the arrow on the left indicates the beginning of the association...

Ngày tải lên: 19/02/2014, 16:20

... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...

Ngày tải lên: 19/02/2014, 19:20

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...

Ngày tải lên: 21/02/2014, 01:21

... he was asleep, collected all the data on the Australian families The next day, Christine presented the Antwerp data and referenced the data of the European groups Next there was a presentation ... at the point of insertion The left half of Alu contains the A and B boxes of the RNA polymerase III promoter The two halves of the Alu dimer are separated by an A- rich region and the 3' end of ... introduce intragenic polyadenylation sites Cytogenet Genome Res 2004, in press 45 Hayakawa T, Satta Y, Gagneux P, Varki A, Takahata N Alu-mediated inactivation of the human CMP-Nacetylneuraminic acid...

Ngày tải lên: 05/03/2014, 23:20

... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...

Ngày tải lên: 07/03/2014, 14:20

... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...

Ngày tải lên: 08/03/2014, 02:21

... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...

Ngày tải lên: 08/03/2014, 09:20

... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...

Ngày tải lên: 08/03/2014, 22:20

... phosphate This occurred in the absence of CoA Taking into account the reaction mechanism of mammalian ACL [23], the final step of the reaction can be assumed to be the nucleophilic attack of CoA to ... effect of ADP As an increased ratio of ADP towards ATP significantly inhibits Cl-ACL activity, we investigated the effect of ADP on the phosphorylation of AclA Addition of 10–100 lM ADP to the phosphorylated ... be assistance of the nucleotide binding to and phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA...

Ngày tải lên: 08/03/2014, 22:20

Ngày tải lên: 12/03/2014, 00:21

... studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are ... Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation ... reveals that the increase of one mode photon density caused in the decrease of the other one Fig 1a Gain coefficient α1 varies Fig 1b Gain coefficient α2 varies D.V Hoang, M.H Hanh / VNU Journal...

Ngày tải lên: 14/03/2014, 13:20

... S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... neighborhood of U {x(U )}, where x(U ) is the root of U The boundary of each puzzle piece P consists of a rectifiable arc in A( ∞) and a rectifiable arc in J(F ) The latter arc starts at an iterated preimage ... notion can be extended to arbitrary domains on the sphere C; it suffices to replace the Euclidean area with the spherical area in the growth condition (2.7) David proved that the analogue of the measurable...

Ngày tải lên: 14/03/2014, 22:20