... Mitsuhashi A, Yamazawa K, Nagai Y, Tanaka N, Mat- sui H & Sekiya S (2004) Correlation between MUC5AC expression and the prognosis of patients with adenocar- cinoma of the uterine cervix. Ann ... by the mAbs against M1. Immunoreactivity of mAbs against M1 towards a recombinant MUC5AC C-terminal cysteine-rich part To test the reactivity of the mAbs against M1 towards the human MUC5AC C-terminal ... part of the figure. The GDPH-cleavage site as well as the epitopes for the mAbs against myc (amyc) and His 5 (aHis 5 ) are indicated. M-C1, N-terminal cleavage fragment; C2-H, C-terminal cleavage...
Ngày tải lên: 07/03/2014, 05:20
Economic Impact of the Abolition of the Milk Quota Regime – Regional Analysis of the Milk Production in the EU – doc
... quota may take place via a variety of administrative and market-based mechanisms including private sales and quota exchanges. MS are able to determine whether transfers take place at national, ... 12,3 12,0 20,6 17,0 19,9 23,9 10,4 6,7 11,7 10,1 14,8 24,8 25,0 8,8 14,1 16,8 17,3 15,7 10,8 8,9 15,9 15,1 28,7 25,2 17,6 13,7 33,1 33,5 0,0 5,0 10,0 15,0 20,0 25,0 30,0 35,0 40,0 Belgium Bulgaria Czek Rep. Denmark Germay Estonia Ireland Greece Spain France Italy Cyprus Latvia Lithuania Luxembourg Hungary Malta Netherlands Austria Poland Portugal Romania Slovenia Slovakia Finland Sweden United ... quotas can be transferred to another producer through either the transfer of an entire farm, the leasing or purchase of quota, or the allocation of quota from a national reserve. The transfer of...
Ngày tải lên: 18/03/2014, 00:20
Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf
... H-bond donor leads to rapid O 2 off-rates [19]. Some of the most unusual Hbs characterized to date are those from nematodes and trematodes (mammalian parasites) such as the nematode Ascaris suum (As) [11,12] ... away from the heme normal (z¢ axis), a is the angle between the projection of the tilt of the z axis on the x¢,y¢ plane (defined direction of tilt of z and the x¢ axis), and j % a + c defines the location ... [55] had proposed a distal Tyr at position E7 as the source of the H-bond to ligand on the basis of a partial sequence, which had indicated a Tyr on the distal E-helix. The similarity in the 1 HNMRspectraofthe three...
Ngày tải lên: 23/03/2014, 17:22
Báo cáo khoa học: Role of the N- and C-terminal regions of the PufX protein in the structural organization of the photosynthetic core complex of Rhodobacter sphaeroides pptx
... between that of the monomeric and the dimeric form ( see above) in mutant PufX54*. As in these last two mutants a short lag was observed (see Table 2), apparently the presence of a stable dimer ... via the plasmid pRKX (in trans) into the host Rb. s phaeroides DQ x/g, deprived of the chromosomal copy of the puf operon. Table 1. Bacterial strains and plasmids. The plasmid host strain in all the ... time of the flash was varied stepwise: for each lag period the amplitude and r ate constant of the exponential function were optimized using a nonlinear v 2 minimization routine [26] an d a plot of...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo khoa học: Structure of the O-polysaccharide fromProteus myxofaciens Classification of the bacterium into a newProteusO-serogroup pptx
... at d 2.01–2.10. These data together suggest that the tetrasaccharide repeating unit of the polysaccharide consists of two residues of GlcNAc and one residue each of GalNAc, GlcA and AlaLys. The 1 Hand 13 C ... gel-per- meation chromatography on Sephadex G-50. Analysis of the polysaccharide using an amino-acid analyzer revealed the presence of GlcN and GalN in the ratio 2 : 1 as well as another amino component. ... O-polysaccharide of Pr. alcalifaciens O23 [23], and an amide of the same amino acid with D -galacturonic acid (structure 2) in the O-polysac- charides of P. mirabilis O13 [24]. An amide of D -galacturonic acid...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo y học: "Penetration of the sigmoid colon to the posterior uterine wall secondary to diverticulitis: a case report" docx
Ngày tải lên: 11/08/2014, 14:20
Báo cáo y học: " Arthritis of the sternoclavicular joint masquerading as rupture of the cervical oesophagus: a case report" docx
Ngày tải lên: 11/08/2014, 19:21
Báo cáo sinh học: "Use of the score test as a goodness-of-fit measure of the covariance structure in genetic analysis of longitudinal data" ppt
Ngày tải lên: 14/08/2014, 13:22
EFFECT OF THE NUMBER OF THE VERTICAL PIPES FOR THE PASSIVE AERATION ON THE COMPOSTING RATE
Ngày tải lên: 05/09/2013, 08:40
Báo cáo khoa học: An arginyl in the N-terminus of the V1a vasopressin receptor is part of the conformational switch controlling activation by agonist docx
... substitution of Arg46 on intracellular signalling The stimulation of accumulated InsPs by increasing concentrations of AVP, was assayed for each of the 19 mutant constructs and the dose–response characteristics compared ... substituted at position 46 and the biological characteristics of the mutant receptors assessed. None of the other amino acids could replace Arg46 whilst still main- taining the wildtype pharmacological ... UK). Mutant receptor constructs Mutation of Arg46 to each of the 19 encoded amino acids was made by a PCR approach. Mutant sense oligonucle- otides (5¢-GGGGGCCTTAGGGGACGTAXXXAATGA GGAGCTGG-3¢) contained...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Role of the hinge peptide and the intersubunit interface in the swapping of N-termini in dimeric bovine seminal RNase pptx
... had an estimated T m of 82 °C. The reverse flanking primer sequence, 5¢-ATATACA TATGAAAGAAAG-3¢, had a calculated T m of 42 °C. The mutagenic primers for each variant are: P1 9A (5¢-AGA GCTGCT AGCAGAGTTG-3¢) ... Each of these variants retains a catalytic activity against yeast RNA comparable with that of parent mBS, indicating that a native conformation is present. A further indication of the similarity ... introduction of Ala for Pro19 makes mBS more similar to RNase A, which has a thermal stability higher than that of mBS. However, P1 9A/ L28Q-mBS has the same thermal stability of the parent protein,...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: Phosphorylation of the arginine/serine dipeptide-rich motif of the severe acute respiratory syndrome coronavirus nucleocapsid protein modulates its multimerization, translation inhibitory activity and cellular localization pptx
... 11507–11512. Supplementary material The following supplementary material is available online: Fig. S1. The SARS N protein is phosphorylated by SRPK1 but not by Clk1 and PKA. This material is available as part of the ... environmental stress, mRNA metabolism is reprogrammed to adapt to stress-induced damage. Translationally stalled mRNAs together with a number of translation initiation factors and RNA-binding proteins are ... Institute of Molecular Medicine, National Tsing Hua University, Hsin-Chu, Taiwan An outbreak of severe acute respiratory syndrome (SARS) occurred primarily in Asia in 2003. The causa- tive agent of SARS...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Structure of the exceptionally large nonrepetitive carbohydrate backbone of the lipopolysaccharide of Pectinatus frisingensis strain VTT E-82164 doc
... 3. Deamination of the de-O,N-acylated LPS and preparation of oligosaccharides 4 and 5 The mixture of oligosaccharides obtained after alkaline deacylation of the LPS (200 mg) was treated with 300 mg NaNO 2 in ... from other Pectinatus strains show a low molecular mass band of the same mobility as in the strain E-82164, and a ladder-like pattern, characteristic of the presence of the O-chain. No bands analogous ... 1. Deamination of the products of complete deacylation of the LPS led to the oligosaccharides 4 and 5, representing undecasaccharide and pentasaccharide fragments of oligo- saccharides 1a and/or 2. These...
Ngày tải lên: 23/03/2014, 18:20
Báo cáo khoa học: Determination of the redox potentials and electron transfer properties of the FAD- and FMN-binding domains of the human oxidoreductase NR1 doc
... Results are the mean and standard deviation of triplicate assays. For the determination of apparent k cat values, experiments were performed at a saturating concentration of NADPH (200 l M ), over a ... potentials. Steady-state enzyme activities The catalytic activity of the NR1-FAD/NADPH domain was examined and compared with the CPR FAD/NADPH domain. The CPR FAD/NADPH domain retains trans- hydrogenase ... 2A) . In the case of the NR1-FAD/NADPH domain, a second 2¢,5¢-ADP-Sepharose affinity step was also incor- porated in the purification scheme, taking advantage of its nucleotide binding capacity of...
Ngày tải lên: 23/03/2014, 21:20
AUDIT OF THE CONTROL SYSTEM GOVERNING THE PRODUCTION, PROCESSING, DISTRIBUTION AND IMPORTS OF ORGANIC PRODUCTS potx
... countries about the content of these annual reports. TABLE 3 RESULTS OF THE COURT’S ANALYSIS OF THE CONTENT OF THE LAST ANNUAL REPORT AVAILABLE AT THE TIME OF THE AUDIT Subject Argentina Israel India New ... countries ‘2. Each Member State shall inform the other Member States and the Commission of each authorisation granted pursuant to this Article, including information on the production standards and control ... organic products 38 61. The Commission’s analysis of annual reports is not standardised (e.g. no checklists or standard report formats are used) and the analysis does not lead to specific actions...
Ngày tải lên: 28/03/2014, 19:20
Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot
... e1–219 variants (e1–220 with additional Pro), the forward pri- mer 5¢-GGTGTA GAATTCAAGAACGAGGAACTGCG-3¢ was combined with (a) 5¢-ATAGTTTAGCGGCCG CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219, (b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ ... solution of the structure of the mammalian AChR molecule. A prerequisite for this is the availability of large amounts of native, sol- uble AChR molecules, a target that can be partially achieved ... 5¢-ATAGTTTA GCGGCCGCTCAATGGTGATGG TGATGGTGCTTGCGGCGGATGATGAG-3¢. For the c1–218 variants (some with an additional C-terminal Pro giving c1–219), the forward primer 5¢-GGTGTA GA ATTCCGGAACCAGGAGGAG...
Ngày tải lên: 30/03/2014, 10:20