the social environment of a medical meeting
Báo cáo khoa học: "SOFTWARE TOOLS FOR THE ENVIRONMENT OF A COMPUTER AIDED TRANSLATION SYSTEM" pptx
Ngày tải lên :
17/03/2014, 19:21
... directly accessed on the screen But the translation is always done by the translator This data base is composed of dictionaries, "formats" and "procedures" of the analysis, transfer and synthesis phases ... phases (the conventional phases of a CAT system) For any given source lexical unit in this data base, VISULEX searches for all the associated information THAM consists of a set of functions programmed ... help translators in several ways, particularly with Machine Aided Human Translation (MAHT) The translator is provided with a text editing system, as well as an uncoded dictionary which may be...
- 4
- 404
- 0
Báo cáo khoa học: "A comparison of five indirect methods for characterizing the light environment in a tropical fores" pptx
Ngày tải lên :
08/08/2014, 14:21
... correlated in a positive way, this suggested that the greater the number of trees or basal area was, the greater the amount of incident light Because the mean density of trees and the mean basal area ... was analysed in the same way The relationship between light variables and quantitative stand variables (ND and BD) was tested with Pearson’s correlation coefficient, whereas an analysis of variance ... radiation The camera was oriented so that the top of each photograph pointed north in order to calculate suntracks for analysis Diazo paper metres were attached to metal stakes at a height of...
- 16
- 317
- 0
báo cáo khoa học: "An attempt to modify allelic frequencies at the Adh locus of a Drosophila melanogaster population in a tropical environment" pot
Ngày tải lên :
09/08/2014, 22:23
... release, a sample of native flies was taken to determine the allelic frequencies in the natural population Another sample was taken at the end of release During the following weeks, new bananas ... supplying a large amount of alcohol to the cultures The aim of the present study was to check the hypothesis of balanced polymorphism in a natural environment A large number of flies genetically marked ... electrophoresis and ADH activity was stained by the usual procedure, using isopropanol as a substrate II1 Results About 000 gcnitically-marked adults were released over a week in the close of the banana baits...
- 6
- 251
- 0
Báo cáo y học: "Evaluation of the psychometric properties of a modified version of the Social Phobia Screening Questionnaire for use in adolescents" pdf
Ngày tải lên :
13/08/2014, 18:21
... used and well established instruments are the Social Anxiety Scale for Children - Revised (SASC-R) [24], the Social Anxiety Scale for Adolescents (SAS -A) [25] and the Social Phobia and Anxiety ... first and second assessment A case-control design was adopted for the evaluation of validity The procedure of a case-control study starts with the selection of known cases and then an appropriate ... the SPSQ-C, i.e a probable case of SAD, the student had to rate at least one potentially phobic situation as "marked fear" on the social fear scale This particular situation had to be consistently...
- 7
- 371
- 0
Báo cáo y học: "The Dictyostelium genome: the private life of a social model revealed" potx
Ngày tải lên :
14/08/2014, 14:21
... repeats are apparently translated to form poly-asparagine, which makes up a substantial fraction of some proteins The description of the whole genome allows the large scale of these repeats in ... amoeba whose genome has recently been sequenced [5] Entamoeba is an intestinal parasite of mammals, causing diseases such as amoebic dysentery - an antisocial amoeba to Dictyostelium’s social amoeba, ... shortly after the plants and shortly before fungi and yeasts In many respects Dictyostelium is closer to animals than are the fungi, because of the greater rate of divergence of the fungal lineage...
- 4
- 314
- 0
The Marketing Strategy of a multinational join stock company.doc
Ngày tải lên :
27/10/2012, 16:51
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company specializes in selling the following: Air conditioners of famous companies such as Toshiba(Japanese), Mitsubishi(Japanese), Trane(American) and Sanyo(Japanese) Medical and technical equipment...
- 25
- 623
- 8
INVESTIGATING HOW GENERAL EDUCATION MIDDLE SCHOOL TEACHERS SUPPORT THE SOCIAL INCLUSION OF STUDENTS WITH SPECIAL NEEDS
Ngày tải lên :
06/04/2013, 11:26
... and admit that they struggle with providing the skills and strategies to facilitate these relationships in their classroom These findings raise a variety of questions about the availability of ... condition that offers a sense 21 of belonging and acceptance of the students While many schools maintain an overreliance on physical inclusion as a way to promote awareness and acceptance of students ... or the assistance of a paraprofessional to deliver one-on-one support, a teacher may, unintentionally, play into the stigma that students with special needs cannot be an integrated part of the...
- 144
- 403
- 0
The social dimension of service workers’ job satisfaction the perspective of flight attendants
Ngày tải lên :
11/09/2013, 11:44
... as one factor of social dimension Organizational reputation can be another factor of the social dimension Organizational reputation is the overall long-term evaluation about the organization by ... derived and the total accountability was 63.64% The value of KMO was Table Result of exploratory factor analysis for organizational characteristic Factors Eigen value Accumulated accountability Wage ... the social dimension outside the organization actually plays an important role in job selection as much as internal factors of the organization 2.2 Social Dimension as a Factor of Job Satisfaction...
- 12
- 569
- 0
Between fathers and fetuses - the social construction of male reproduction and the politics of fetal harm
Ngày tải lên :
01/11/2013, 08:20
... symbols of the ‘crack baby’, ‘pregnant addict’ and ‘absent father’ emerged at the center of debate over fetal hazards (A more detailed analysis of the social and political construction of these ... absence of fathers in news reports of crack babies was made easier to believe by the racial subtext of the story: African–American women are often characterized as abandoned, single mothers – ... protectionism and fetal rights.) Between fathers and fetuses ‘Crack babies’ and ‘pregnant addicts’ By now, the images of the crack baby and addicted mother are familiar to anyone who has read news...
- 18
- 862
- 0
Genes and the social environment
Ngày tải lên :
01/11/2013, 09:20
... hallucinatory and paranoid behaviour Study participants had previously (at ages 13, 15 and 18) been asked whether they used cannabis: a quarter of the sample were classed as adolescent-onset cannabis ... schizophrenia has demonstrated that even after multiple replications of association between a disorder and a gene or region on the chromosome, the precise location of the causal variant or variants can ... cannabis users because they had used cannabis before the age of 15 or were using it at least monthly by the age of 18 These adolescent-onset cannabis users had an overall increased risk of adult psychosis,...
- 17
- 585
- 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
- 6
- 428
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
Ngày tải lên :
19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: The social life of ribosomal proteins doc
Ngày tải lên :
19/02/2014, 17:20
... affinity of the ribosome for single-stranded RNA in a nonsequence-specific fashion as well as keeping ‘unused’ parts of the mRNA away from functionally active parts of the ribosomal 2101 The social ... that presumably are stacked in the interior of the penultimate helix 44 of 16S rRNA in the absence of tRNA [25,40] Upon cognate tRNA interaction with the base triplet on mRNA in the A site, the ... as we hope to have illustrated above, ribosomal proteins are still much more than merely ‘RNA glue’ that hold the ribosomal RNA in place – they have a real social life! Being at the surface of...
- 11
- 563
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
Ngày tải lên :
19/02/2014, 19:20
... Wordnet::similarity - measuring the relatedness of concepts In Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... choose as final answers based on the sense pair similarity scores We choose the Indegree algorithm used in (Sinha and Mihalcea, 2007; Guo and Diab, 2010) as our disambiguation algorithm It is a graphbased...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...
- 12
- 740
- 0
Evidence-Based Medicine and the Changing Nature of Health Care: Meeting Summary docx
Ngày tải lên :
06/03/2014, 09:20
... into infrastructure for the gathering and analysis of healthcare data and information, and standards and protocols to ensure their accuracy and reliability Shift to a culture of care that learns ... Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding engineers It is autonomous ... would also need a private and secure data storage and sharing platform enabling the exchange of data between thousands of health applications and devices Along these lines, the company released...
- 203
- 460
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
Ngày tải lên :
08/03/2014, 02:21
... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
Ngày tải lên :
08/03/2014, 09:20
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...
- 6
- 387
- 0