the small protein was a cu

... 5'- GTACGTATTTTTACAACAATTACCAACAAC-3' and 5'-GGATTCAATCTTAAGAAACTTTATTGCCAA-3', and then sequenced by a primer 5'-CCCCCCCCCCCCD (A or G or T)-3'. Construction and ... pGEM-T easy (Promega). An orf of nptII, which confers resistance to kanamycin, was amplified by primers 5'-ATGTCTA- GAAGCTATGACCATGATTACGAA-3' and 5'-ATGTC TAGAAAGTCAGCGTAATGCTCTGCC-3' ... 5'-CACCGAGAAGTCAACAGCTCGGTCATCGAC-3' and 5'-TCAAGTCTTCCAATTTCTACCCAGTGCTGC-3' for AtYLMG1-1, 5'CCTCAACATATATAACACCATC-3' and 5'-GACAGGTTCAGGTCATAGAAG-3'... Page 11 of 13 antibodies (AS07217, Agrisera) as described

Ngày tải lên: 12/08/2014, 03:21

... CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG ... mRNA for rapid degradation remains largely to be determined It is not yet clear whether AREs are the actual targets for ribonucleases and/or whether trans-acting factors lead to an increase in the ... (1139 bp) was cloned in frame via the BamHI and SmaI sites downstream of the GST (glutathionine S-transferase) gene into GEX-2T (Amersham-Pharmacia) and was called pGEX-HuD pGEX-HuR was constructed

Ngày tải lên: 08/03/2014, 08:20

... and Ran (Fig 1) Ras superfamily small G protein Ras Rho ARF ClassI :ARF1 , ARF2 , ARF3 ClassII: ARF4 , ARF5 Rab ARF Arl Arl1, Arl2, Arl3, Arl4, Arl5, Arl6, Arl7, ARFRP1, ARD1 ClassIII: ... human ARF3 human ARF3 human ARF4 human ARF4 human ARF5 human ARF5 human ARF6 human ARF6 rat Arl1 rat Arl1 human Arl5... Golgin-97 and Golgin-245 from the Golgi apparatus xiv Abbreviations: ... have diverse localizations and have been reported to localize to the Golgi apparatus (class I, II ARFs, and Arl1), endosomes (ARF1 and ARF6 ), plasma membrane (ARF1 , ARF6 and ARFRP1)

Ngày tải lên: 17/09/2015, 17:20

... of partially denatured actin that can trap intact actin. The 3D mutant prevents aggregation and by this means increases the quantity of available actin monomers and therefore increa- ses the ... intact protein, weakly bind ANS, contain rather small quantities of high molecular mass aggregates, are more resistant to trypsinolysis than intact actin and retain the ability to polymerize. Actin ... were scanned and evaluated by the ONEDSCAN program. The intensity of the band of unhydrolyzed actin was plotted against the time of incubation. Characterization of actin preparation quality Fluorescence

Ngày tải lên: 20/02/2014, 23:20

... of Tris and EDTA The final concentration of EDTA was mM Under these conditions, the pale blue of the supernatant at pH 6.0 became deep blue at pH 8.0 The supernatant was passed through a syringe ... possesses the same characteristics of the interior of the protein matrix The script a is the peak–peak distance between the maximum at %287 nm and the minimum at %283 nm, and the script b is the peak–peak ... removing NaCl by prolonged dialysis, this protease is activated and cleaves PsbQ at low salt concentrations We circumvented the drawbacks of the 1-M NaCl wash by taking advantage of the Cu2+ effect

Ngày tải lên: 21/02/2014, 00:20

... Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana Oligomerization and thermotolerance Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae Department ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT p26-CD10 183–192 (p26-1Bam-s) GCGCGGATCCACCATGGCACTTAACCCATG 546/182 (P26-182 Xho-as) CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT p26-alpha 1–60 and (p26-60Bam-s) GCGCGGATCCACCATGTCCTTGAGGGACACA ... Dalhousie University, Halifax, Nova Scotia, Canada Oviparously developing embryos of the brine shrimp, Artemia franciscana, synthesize abundant quantities of a small heat shock/a-crystallin protein,

Ngày tải lên: 22/02/2014, 04:20

... molecules impaired the catalytic activity of SRPK1 ⁄ 1a, whereas the nuclear subfraction of the kinases, which was found to be associated with the nuclear matrix via SAFB proteins, was inactive ... each one of the SRPK family members and the significance of the ‘spacer domain’ for the functional properties and the particular regulation of each kinase l The extra- and intracellular signals ... Giannakouros et al speckles to the cytoplasm [10] Acinus was originally identified as a target of caspase-3, a cysteine protease involved in activating chromatin condensation and nuclear fragmentation

Ngày tải lên: 06/03/2014, 01:20

... Federal Reserve banks, federal-funds target rate of the Fed). These rates have a profound effect on the market rates of the money market; and it is the market rates—not the central-bank rates—on which ... for these rates and curiously, although Palgrave was a leading contemporary observer of the money market, these rates are substantially above those reported in contemporary issues of the ... markets in respect of private transactions; but central-bank intervention can influence a money-market rate. The central bank acting alone affects price via its transactions with commercial banks

Ngày tải lên: 06/03/2014, 14:20

... siRNA selection [43] The first siRNAZF5 5¢-GGUUGAGGAUGUGAAAUUCUU-3¢ and 5¢-GAAUUUCACAUCCUCAACCUU-3¢) matched bases 192–210; the second siRNAZF5 (5¢-GAGGAAGCAUGA GAAACUCUU-3¢ and 5¢-GAGUUUCUCAUGCUUCCU ... first pair of primers (5¢-GGCCTTCAAGGCATTAAG-3¢, 5¢-AAACAAATGG CCTGTCCG-3¢) spanned a 958 bp 5¢-part of the ZF5 coding region; the second pair (5¢-CCCCTCAAGCCTT AACAT-3¢, 5¢-TCTCCACTTTCCAGGCAA-3¢) ... 5¢-GAGUUUCUCAUGCUUCCU CUU-3¢) matched bases 945–963; and the third siRNA ZF5 (5¢-GGUCCUGAACUACAUGUACUU-3¢ and 5¢-GUAC AUGUAGUUCAGGACCUU-3¢) matched bases 333–351 of the ZF5 mRNA sequence (accession number

Ngày tải lên: 07/03/2014, 05:20

... aaagtgaagtcc-3¢ and 5¢-attattggatccctattgctggtccgattctgccag-3¢ 3-TPR NlpI primers (residues 62–197) were 5¢-aataatccatgg gggcacagcttttatatgagcgcggag-3¢ and 5¢-aataatggatcctcactgttc cttatccgatttttcgaagtgc-3¢ ... chemically synthesized by the W M Keck Core Facility (Yale University, New Haven, CT, USA) Primers to amplify mature NlpI (residues 20–294) were 5¢-aataatccatggggagtaatacttcctggcgta aaagtgaagtcc-3¢ ... particular interest because it is a membrane-associated protein, and mutations in it alter septation and virulence Repeat proteins in general, and tetratricopeptide repeats (TPRs) in particular,

Ngày tải lên: 07/03/2014, 16:20

... 5¢-CG GGATCCCAATCTGTTGCTAA TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢) for ampli- fication of the region from )180 to )36 and (5¢-GA AGAT CTAACTAGATTTTACCATTGG-3¢) for amplification of the region ... stranded oligonucleotides spanning the region from )70 to )36 of t he xMGP promoter (5¢-GATCCAGGGGAGGGAAAACAAGGA GATGAGGAGGTGTGGT-3¢,and5¢-GATCTACCA CACCTCCTCATCTCCTTGTTTTCCCTCCCCTG-3¢) as BamHI/BglII ... sequence (TAAATA) is located between base pairs )28 and )23. A CCAAT-consensus box is located at )86 bp (CCAAT), a reverse CCAAT motif lies at )825 bp (ATTGG) (Fig. 1). In addition, the xMGP gene

Ngày tải lên: 08/03/2014, 10:20

... [27] was used for secondary structure evaluation, solvent accessibility calculation, angular order parameters calculation, inter-helical angle calculation, and for protein structure figure preparation ... examine the electrostatic character of the structure of RIIa D/D we have predicted mean apparent pKa values, based on Poisson–Boltzmann electrostatic calculations, using an ensemble of calculated ... dual-specificity AKAPs (D-AKAPs) indicates that the type I enzyme may also be localized [4] The N-terminal dimerization domain of the Type IIa regulatory subunit of PKA, called hereafter RIIa

Ngày tải lên: 08/03/2014, 22:20

... economy than they are to the urban economy 61% SAN JUAN WAHKIAKUM COLUMBIA ISLAND PACIFIC JEFFERSON DOUGLAS CLALLAM FERRY OKANOGAN LINCOLN KITTITAS ADAMS KITSAP STEVENS WALLA WALLA GARFIELD... ... better than average in all categories Bottom Five States: Minnesota, Alaska, Missouri, West Virginia, Louisiana Washington’s Rank: 12 Explanation of Washington’s Rank: Washington ranks in the top ... and rank poorly in no more than one or two categories Bottom Five States: West Virginia, Mississippi, South Dakota, Arkansas, Alabama Washington’s Rank: 4 Explanation of Washington’s Rank: Washington

Ngày tải lên: 16/03/2014, 01:20

... MeMIH-B was amplified by PCR using T7 promoter-linked primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢). For PCR, the reaction ... and the final dialysis was against 0.1 · NaCl ⁄ P i over- night. A Bradford protein assay (Bio-Rad, Hercules, CA, USA) was performed to determine the concentration of the refolded protein. The ... 5¢-AGGAGATCTAAGCTTACCA CGCTCCACCAGGG-3¢) that contained restriction sites EcoRI and BamHI, respectively. The PCR product was first digested with EcoRI and HindIII, and was then ligated into the

Ngày tải lên: 16/03/2014, 05:20

... 4C), whereas s-DAPK-1Dtail was almost as active as full- length DAPK-1 (Fig. 4C). These data indicate that the ‘tail’ of s-DAPK-1 has a negative regulatory function with regard to s-DAPK-1 activity, and ... trans- fection, the same lower protein band was observed in the Flag–s-DAPK-1- and the Flag–s-DAPK-1-Myc- transfected cells, whereas the upper band in the Flag– s-DAPK-1 transfection lane was slightly smaller (Fig. ... membrane blebbing. A function was also attributed to the unique tail of s-DAPK-1: it can regu- late the localization and half-life of the protein and Fig. 4. The C-terminal tail of s-DAPK-1 negatively...

Ngày tải lên: 18/02/2014, 17:20

... their development as “Americans” was their commitment to a faith that was unapologetically antidemocratic, anti-individualistic, and anti-aesthetic. Abernethy agreed that New England’s poets would ... times among these stones over the decades. As at Elizabeth’s burial, he knew that he was to proclaim – and to proclaim it so clearly that no hearer in heaven or earth could miss it – that there was but ... ritual of grieving that it was written to demonstrate and encourage. Strip away that ritual, and the life of the text evaporates. 4 To readers alienated from the original a ective contexts of the Puritan...

Ngày tải lên: 21/09/2012, 11:00

... innovations and the rapid spread of useful ones. Because of the rapid spread, however, the original innovator may gain little market advantage and so may have little reason to innovate in the ... standards are a major issue for the three layer model, as they ensure that (agents in) the individual layers can easily interface with (agents in) the other ones. Organisations such as the ... The dynamic nature of the information on Internet: information that cannot be found today, may become available tomorrow. And the reverse happens too: information that was available, may...

Ngày tải lên: 08/10/2012, 15:22

... states “intercultural awareness, as a fundamental feature of language and an integral part of language learning, is important at all level.” Briefly, regardless of different points of view, the ... Vietnamese teachers and students can have a better understanding of culture knowledge 40 1. Explain to the class that by looking at the front page of a newspaper, they can learn a great deal about ... understands that people generally act the way they do because they are using options society that allows for satisfying basic physical and psychological needs, and that cultural patterns are interrelated...

Ngày tải lên: 07/11/2012, 15:06

... trình xâm lược c a chủ ngh a thực dân ở các nước Đông Nam á 1. Đặc điểm các nước Đông Nam á Vị trí đ a lý quan trọng Tại sao nói khu vực Đông Nam á là nơi có vị trí đ a lý quan trọng? I Quá ... đông nam á in-đô-nê-xi -a Phi lip - pin Miến Điện Các nước Đông Dương : Cam Pu - Chia Cu c K/N do A- cha-Xoa lÃnh đạo Cu c K/N do nhà sư Pu-côm-bô lÃnh đạo I Quá trình xâm lược c a chủ ... Đông nam á in-đô-nê-xi -a Phi lip - pin Miến Điện Các nước Đông Dương : Lào Cu c đấu tranh do Pha-ca-Đuốc lÃnh đạo K/N ở Cao nguyên Bô- Lô- Ven I Quá trình xâm lược c a chủ ngh a thực...

Ngày tải lên: 24/06/2013, 01:28

... Ban Nha rồi sau đó đến Mĩ để giành độc lập dân tộc. + Campuchia, Lào, Việt Nam: - Campuchia: Khởi ngh a c a A-cha-xoa, nhà sư Pu-côm-bô… - Lào: Pha-ca-đuốc khởi ngh a vũ trang ở Xa-van-na-khét, ... c a Anh và Pháp. A P Vì sao nhân dân Đông Nam Á tiến hành cu c đấu tranh chống chủ ngh a thực dân? Mục tiêu chung mà các cu c đấu tranh đặt ra là gì? BẢN ĐỒ ĐÔNG NAM Á Cu c đấu tranh c a ... NƯỚC ĐÔNG NAM Á • D a vào lược đồ dưới đây hãy xác định tên các nước Đông Nam Á ? VIỆT NAM 3 VIỆT NAM 2 LÀO 5 CAMPUCHIA 4 THÁI LAN 1 MIANMA 6 MALAIXIA 7 XINGAPO 8 BRUNÂY 9 INĐÔNÊXIA 10 PHILIPPIN ...

Ngày tải lên: 20/08/2013, 03:10