the shocking truth c arrays and pointers are not the same

... 5'-CAGTGGGGTCTTTGTGACCT, rev: 5'GCGTTAGAGACGTTGGAACC-3' for MMP2 -735 C/ T), and 0.2 µM of probe (5'-fluorescein-CCCAGCACTCCACCTCTTT-3' for MMP2 -1306 C/ T; or 5'-fluorescein-GAATGCGGACCCTCCTGG-3' ... Foster City, USA), 1.5 mM MgCl2, 1× PCR buffer, 200 µM dNTPs (Invitrogen, California, USA), 0.5 µM of each primer (forw: 5'-CTTTCTTCTCCAGTGCC-3'; rev: 5'CCCTAAACTAGTAAAGAC AATCA-3' for MMP2 -1306 C/ ... index, moles, freckles, and race Associations between number of high-transcriptional-activity alleles and the AJCC, American Joint Committee on Cancer ; CI, confidence interval; CMM, cutaneous malignant...

Ngày tải lên: 11/08/2014, 08:21

... arrows Amino acid sequences from (accession numbers in parenthesis) Saccharomyces cerevisiae (NP_014776), Saccharomyces castellii (AAO32487), Saccharomyces kluyveri (AAO32562), Glugea plecoglossi ... SC-Ura-Leu for selection of positive colonies After days at 30 C, positive colonies were selected and the replacement of the genomic copy of eEF2 by LEU2 was confirmed by PCR and sequencing The ... 3¢-sequences flanking the genomic eEF-2 in strain YOR133w The purified PCR fragment was introduced into the GA1 cells and the genomic eEF2 coding sequence replaced by the LEU2 gene via homologous recombination...

Ngày tải lên: 07/03/2014, 05:20

... GGACTTGGTGGATTGGCCTGGCA AGTTACCAAATACCAAGAAT ACATCTACCACCGCCACAGG GGTTCGTGCCTTCATCCGTCGACTTTCCT CCCTTTTTCCACAGG CGCCACCTAACAATTCGGTCGACCTTATG GGATAATAGGTTGC TTGTAATTTCTGCTTGATATC TGACGCACCTCGAGTCGACGGATGA ... GGTTCGTGCCTTCATCCGTCGACCAAC CTGGCCAGGTAGGGCTAGACACA CATGGTTAGCCCCATTCATA CATATGAAATACGTTGATGAATATC ATTGTCGGATCCCAGCAAAACT CATATGAACTTAGTCTGTCCCGTTCCC CTTGTCGACTGGAGTCCTAACAAATACGG CATATGTTAAAAACCGTTGCCATACAG GGATCCAGTTGAGTTAACAGATATATTGC ... TTTTTCCTTCAACTCTTAG CATATGCACCAATCCATTGAC TTTTACTGTGTTGATTTTGA TCCTTTCCTCATATGTGTCTAGCC TCTTAACTCGTCGACTTAAACTCCCAT TTGGGCATACTTTATCTGGC CGCCACCTAACAATTCGGTCGACTGAT AGACTTGGCAGAAATGGGAGTTT GGTTCGTGCCTTCATCCGTCGACCAAC...

Ngày tải lên: 08/03/2014, 08:20

... Mahan JD, McBryde KD, Benfield MR, Goldstein SL: The effect of vascular access location and size on circuit survival in pediatric continuous renal replacement therapy: a report from the PPCRRT registry ... strategies and providing recommendations to operators in the field are welcome and urgently needed Competing interests The authors declare they have no competing interests References Del Castillo ... outcomes of acute renal failure: a prospective randomised trial Lancet 2000, 356:26-30 Uchino S, Fealy N, Baldwin I, Morimatsu H, Bellomo R: Continuous is not continuous: the incidence and impact...

Ngày tải lên: 13/08/2014, 11:22

... with increase in membrane-bound PKC activity and did not increase the activity of immunoprecipitated PKCf Fifth, the action of insulin on glycogen synthesis was not abolished by the speci c PKC inhibitor, ... membrane fraction (Table 2) In control experiments, the conventional cPKCa and the novel nPKCs d and e, but not the atypical aPKCf, were translocated to the membrane fraction by the phorbol ester, ... hepatocytes with ATP or PLC was speci c for certain molecular species, diacyl, alkylacyl and alk-1-enylacyl subclasses were separated and their molecular species composition was determined by combined...

Ngày tải lên: 20/02/2014, 02:21

... [15] Acute HCV infection can be cleared spontaneously only in up to 15–30% of the cases, while usually the infection becomes chronic Within 20 to 30 years chronic HCV infection can progress to cirrhosis ... KN and KM constructed the expression vectors and produced and purified the recombinant HCV proteins and used these proteins to screen the patient sera for HCV antibodies ML genotyped the HCV ... Tyni, and V Mäkinen for excellent technical assistance This study was funded in part by the Medical Research Council of the Academy of Finland, the Finnish Cancer Foundation and the Päivikki and...

Ngày tải lên: 12/08/2014, 04:21

... tell your C# compiler to check all of your code for CLS compliance The Role of the Base Class Libraries In addition to the CLR and CTS/CLS specifications, the NET platform provides a base class library ... to call C# a Java rip-off is inaccurate Both C# and Java are members of the C family of programming languages (e.g., C, Objective C, C+ +) and therefore share a similar syntax The truth of the ... iteration and decision constructs, narrowing and widening operations, and the unchecked keyword Chapter 4: Core C# Programming Constructs, Part II This chapter completes your examination of the core...

Ngày tải lên: 04/10/2013, 14:07

... returns the uppercase equivalent of its character argument, to convert each character in the string The toupper( ) function uses the header Notice that the test condition of the for ... Two-dimensional arrays are stored in a row-column matrix, where the first index indicates the row and the second indicates the column This means that when array elements are accessed in the order in which they ... Herbert Schildt Ask the Expert Q: Are pointers and arrays interchangeable? A: As the preceding few pages have shown, pointers and arrays are strongly related and are interchangeable in many cases...

Ngày tải lên: 27/01/2014, 02:20

... detected by western blot Casp3 clved, cleaved caspase-3 TTTTTCAGTGCAGAA-3¢; aP2 forward, 5¢-AAAGACA GCTCCTCCTCGAAGGTT-3¢; and aP2 reverse, 5¢-TGA CCAAATCCCCATTTACGC-3¢ Standard curves were generated ... Akt-1 reverse, 5¢-TTGTC CTCCAGCACCTCAGG-3¢; CD36 forward, 5¢-TCCAGC CAATGCCTTTGC-3¢; CD36 reverse, 5¢-TGGAGATTAC FEBS Journal 277 (2010) 687–696 ª 2009 The Authors Journal compilation ª 2009 FEBS ... ⁄ EB in culture medium and visualized by confocal microscope (Leica TCS SP2 Confocal Microscope System, Leica microsystems, Wetzlar, Germany) Ten microscopic fields were captured for each sample...

Ngày tải lên: 16/02/2014, 09:20

... basic properties of the Src activation/deactivation cycle Kinetic scheme of the Src cycle Src activity is regulated by intramolecular and intermolecular interactions that are controlled by tyrosine ... of the Src cycle When there are three intersections, the steady state O1 at the lower branch of the Z-shaped curve (i.e low Src activity) and the state O3 at the upper branch (i.e high Src activity) ... understand this excitable behavior by presenting the pulse of Src activity in the plane of the inactive and active fractions, si and s1 If the duration of the stimulus exceeds the critical value, the...

Ngày tải lên: 18/02/2014, 11:20

... immunoprecipitation with the antiFlag Ig, however, c- actin could be detected only in the BAP31 immunocomplex In particular, the immunocomplex Fig The pre-apoptotic BAP31 complex specifically recruits c- actin ... the interaction between actin and myosin in the actomyosin complex [19,20] The acetylation of the N terminus removes a positive charge and increases the interaction between actin and myosin compared ... [18]) and nonmuscle myosin heavy chain type B and nonmuscle c- actin, two components of the cytoskeleton actomyosin complex A speci c interaction of myosin with BAP31 is supported by the presence...

Ngày tải lên: 20/02/2014, 23:20

... genes CytOX5a and CytOX5b, coding for the two isofoms Va and Vb, parallels that of genes CYC1 and CYC7, which encode iso-1 and iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed ... aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 are co-expressed under hypoxic (O2 < 0.5 lM) and heme deficient conditions [11] The coexpression of speci c subunit V and cytochrome c isoforms ... nonspeci c and toxic effects in animals To ascertain that the effects of these agents, on the catalytic activity and subunit composition of CytOX were related to their hypoxia-speci c effects, we...

Ngày tải lên: 20/02/2014, 23:20

... in the conformation of the chelate rings The characteristic alternate pattern of the dd bands in the CD spectra is dictated by the conformation of the sixmembered chelate ring involving the His ... (Fig 1) This conclusion is a direct consequence of the presence of the same kind of spectrum for 4N complexes of GGH, where the a carbon of the His residue is the sole source of chirality [10] ... On the other hand, the direct thermodynamic and kinetic characterization of Ni(II) binding at site I in HSA and BSA was obtained These data can be very useful in further studies of the toxicologically...

Ngày tải lên: 22/02/2014, 04:20

... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... Fe(III)-nitrilotriacetic acid concentration, and Ks is the halfvelocity constant As we have determined the OmcA and OmcB concentrations present in omcB– and omcA– cells, respectively, and because omcA– omcB– ... Synthetic oligonucleotides used in this study Oligonucleotide name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT...

Ngày tải lên: 07/03/2014, 09:20

... 5¢-ATATGTAT ACCCGCTATCATCACATTGTCCCTAATGCAAATCC TTTTTCC-3¢, that introduces the AfiG substitution in position 287 of the SsAH gene Bstz17I PCR amplification was performed at 95 C for 30 s, 58 C for ... from the initial ATG with the oligonucleotide forward primer: NcoFOR_1, 5¢-CTCTCC ATGGGAATTAAGTTACCCACATTGGAGGA-3¢, carrying the sequence for the NcoI restriction site, and a second oligonucleotide ... synthesized Forward and reverse primers correspond to the first 20 nucleotides at the 5¢- and 3¢- of the gene coding sequence and include the NcoI and BamHI sites, at each end, respectively The...

Ngày tải lên: 07/03/2014, 21:20

... both the cytosol and the nucleus of a stimulated transgenic tobacco cell culture By contrast, JA–Ile treatment had no detectable effect on the cellular Ca2+ content of the examined cell culture ... indole-3-acetic acid Thereby, the velocity of the gravitopic movement is seemingly accelerated [51–54] The majority of the effects described by the Nick group are most likely not OPDA speci c, but rather ... lipoxygenases (LOX), which are capable of introducing molecular oxygen at either the C9 or C1 3 position of the C1 8 fatty acids linoleic acid (18:2) and a-linolenic acid (18:3), respectively [10,11] Plants...

Ngày tải lên: 16/03/2014, 02:20

... electron microscopic identification [5] of two morphologically distinct classes of caveolae at the plasma membrane ) canonical caveolae that are open to the extracellular space and caveolae lacking ... microfilaments [28] HD-caveolae as sites of fatty acid uptake and triacylglycerol synthesis We have previously used biochemical analysis, fluorescence confocal microscopy and electron microscopy ... identify the HD-caveolae as speci c sites of fatty acid uptake and conversion to triacylglycerol, including the unique presence of fatty acyl-CoA synthetase and perilipin in these caveolae [10] These...

Ngày tải lên: 16/03/2014, 13:20

... tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag ... CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG 720 GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc ... CGGTACTGGAGGCACCACTGCGGGGGCTCCCTGATCCACCCCCAGTGGGTGCTGACCGCAGCCCACTGCGTC 216 GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288 CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG...

Ngày tải lên: 17/03/2014, 09:20

... bvgS alleles the oligonucleotides bvgS -C4 -a (5¢-GCTGGG CGAACTCAAGAGCATCATCGGCGG-3¢) and bvgSC4-b (5¢-CCAGCCGCCGATGATGCTCTTGAGTTCG CC-3¢), bvgS-Qmut1 (5¢-GCCCGCGAAATGGCCGAG TTCCTGCTC-3¢) and bvgS-Qmut2 ... (5¢-GAGCAGGAAC TCGGCCATTTCGCGGGC-3¢) and bvgS-Del-a (5¢-GA CCCGGCGCTGACGCGCGTGGCC-3¢) and bvgS-Del-b (5¢-GGCCACGCGCGTCAGCGCCGGGTC-3¢) were used All proteins used in this study are shown schematically ... switch between aerobic and anaerobic growth conditions The ArcAB regulon comprises factors involved in electron transport, the citrate cycle, the glyoxylate shunt and lipid metabolism [21] Recently,...

Ngày tải lên: 17/03/2014, 23:20