0

the secret to learning a language in 10 days download

The complete guide to learning a language doc

The complete guide to learning a language doc

Anh ngữ phổ thông

... learning style?Again, consider whether the layout and print suit you.Does the book explain things well? Look at grammaticalexplanations in the text and in the grammar section at the back. ... education training in Great Britain now have to have a good pass in their first foreign language - they'regoing to have to teach it soon!4. You may be going to ... GUIDE TO LEARNING A LANGUAGE Later, we shall also look at how you can use email and the internet for extending your learning. There are also some authoring programs - such as...
  • 190
  • 375
  • 3
The Secret to Winning a Start-up Competition

The Secret to Winning a Start-up Competition

Quản trị kinh doanh

... is called CoffeeTable, and it's a beautifully-designedand simple -to- navigate app for viewing retail catalogs on an iPad. (As of this week, the app isalso available for the iPad Mini and ... retail-as-therapy) that may explain why retail catalogs continue to bebrowsed, hoarded, and even prominently displayed in homes. In other words, why print catalogsstill exist despite Amazon. And ... ShopAdvisor, a save-it-for-later service that alerts consumers when an item they want to buy is available, or when it drops to a certain price. It's already used by digital magazines, brand...
  • 3
  • 380
  • 0

Báo cáo khoa học

... 6: The graph of micro-average F -measureagainst the number of training sentences duringtext chunking (A: MHHMM, B: HHMM and C:HMM) The first finding is that the size of training datadramatically ... that the partially flattened hierarchical hid-den Markov model (PFHHMM) can assign propo-sitions to language texts (grammar parsing) at leastas accurately as the HMM. This is assignment is a task ... Hierarchy in a modified hiddenMarkov modelLin-Yi ChouUniversity of WaikatoHamiltonNew Zealandlc55@cs.waikato.ac.nzAbstractThis paper explores techniques to take ad-vantage of the fundamental...
  • 8
  • 528
  • 0
Seminar: Sumary of the book “5 Steps to Speak A Language” doc

Seminar: Sumary of the book “5 Steps to Speak A Language” doc

Khoa học xã hội

... learning a new language, your brain is “drawing” a new language “map”. Our strategy is to expedite the process by proactively “drawing” it without waiting for the brain to draw the map in a ... an example of a typical learning approach that we can observe in many foreign language learning classes. Teacher says: ã Listen to me and then repeat (normally the whole class repeats altogether) ... recognition” and “association” and not on logic. You can think about “pattern recognition” and “association” as the way in which the brain starts to draw a new map as you learn a new language. The input...
  • 44
  • 574
  • 0
''''The Worst Place in the World to be a Woman or Girl'''' – Rape in the DR Congo: Canada, Where Are You? docx

''''The Worst Place in the World to be a Woman or Girl'''' – Rape in the DR Congo: Canada, Where Are You? docx

Khoa học xã hội

... Council—African Union Peace and Security Council.” 67 CIDA, “Canada and the G8 Africa Action Plan: Maintaining the Momentum,” 12; finally Canada financially supported the Goma Peace Process that took ... terminated the mandate of the Canadian ambassador to the Great Lakes Region, who had represented Canada in peace processes in the region. In 2008, when the CNDP marched on the The Africa Canada Accountability ... map accessible to the global public. Canada, as the largest non-African investor in the DRC's mining industry and global leader in mineral exploration, has a wealth of knowledge about the...
  • 27
  • 415
  • 0
CAREERS IN FINANCIAL MARKETS - YOUR GUIDE TO FINDING A JOB IN SECURITIES AND BANKING 2010-11: Navigating the New Landscape docx

CAREERS IN FINANCIAL MARKETS - YOUR GUIDE TO FINDING A JOB IN SECURITIES AND BANKING 2010-11: Navigating the New Landscape docx

Tài chính doanh nghiệp

... rankings in a similar format, making it easy for investors to compare the ratings of one organization to another. A debt issuer rated AAA (in the for-mat used by S&P and Fitch) or Aaa (in the ... information about litigation and administra-tive proceedings against firms and individuals, as well as EDGAR (Electronic Data Gathering, Analysis, and Retrieval), a database of public company ... returns. In a plain vanilla interest rate swap, for instance, one side agrees to pay a constant (“fixed”) rate on each payment date and the counterparty pays a variable (“floating”) rate that will...
  • 100
  • 555
  • 0
Tài liệu The Return to Knowledge of English in Non-English Speaking Country docx

Tài liệu The Return to Knowledge of English in Non-English Speaking Country docx

Kỹ năng nói tiếng Anh

... Israel can be juxtaposed with the 6% estimated return to education in the data. The time to fluency in a second language (at least for English-speaking adults learning a Germanic language in intensive ... who claim to have spoken a language very wellwhen they began their job cannot show gains in their knowledge of that language. Perhaps, the way the data are recorded masks a correlation in acquisition ... Israelis working in the sameoccupations and workplaces as the immigrants. As in BLS, we have data on language knowledge and wages at two points in time. Thus, we are able to examine how the wages...
  • 29
  • 565
  • 0
Tài liệu Speedwealth - How to make a milion in your own business in 3 years or less doc

Tài liệu Speedwealth - How to make a milion in your own business in 3 years or less doc

Quản trị kinh doanh

... facilities already established.I have an acquaintance who found a particularly goodengine additive that was selling like “hot cakes” in the U.S., but the manufacturer wasn’t marketing it anywhere ... rich! Today, these changes are happening by the minute and every day people are becoming millionaires bytaking advantage of them. You can too!Creating wealth quickly has almost become a necessity.Because ... specializes in using the “Rags to Riches” approach. Hehas a knack for starting with little and earning large amounts ofmoney, quickly. His passion is teaching others to do the same! Starting...
  • 102
  • 646
  • 0
Tài liệu StrategieS for SucceSS: How to Write a Grant in Cancer CAM docx

Tài liệu StrategieS for SucceSS: How to Write a Grant in Cancer CAM docx

Sức khỏe giới tính

... subgroup analyses. See also valid analysis. Asian A person having origins in the original peoples of the Far East, Southeast Asia, or the Indian subcontinent including, Cambodia, China, India, ... Certification American Indian or Alaska Native A person having origins in the original peoples of North, Central, or South America who maintains tribal affiliation or community. Analysis ... representative. In addition, applicants need to be realistic in their estimates of accrual rates in clinical CAM research. Accrual in clinical investigations using CAM products and interventions...
  • 61
  • 517
  • 0
Tài liệu SOA Governance: The key to successful SOA adoption in your organization doc

Tài liệu SOA Governance: The key to successful SOA adoption in your organization doc

Kỹ thuật lập trình

... gure:ApplicationUserInterfaceBusinessLogicDataApplicationUserInterfaceBusinessLogicDataApplicationUserInterfaceBusinessLogicDataWhen the need arose for these applications to communicate, the generally accepted approach was to create an adapter that acts as the glue ... occurred to the applications, and their knowledge was out of date. The way in which they had represented the data in the operation was a complete mismatch to the processing model within the auto insurance ... insurance application. While all the data was there, the way in which the data was organized would require Jennifer's team to completely disassemble the data and reassemble it in the data...
  • 229
  • 1,693
  • 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khoa học

... disRAS1fwd5Â-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3Â and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3Â. YEp351-SUT2 wasconstructed to contain SUT2 as the only open readingframe present in the plasmid in ... http://mips.gsf.de/proj/yeast/info/tools/hegemann/gfp.html) using the primersSUT-GFPfwd 5Â-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3Â and SUT-GFPrev 5Â-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3Â, ... frame was ampliedusing the primers Flo11_lacZ_fwd 5Â-GTTTAGAATTCGATTGTAGGCAGAA-3Â and Flo11_lacZ_rev5Â-AGGATCCAAATAAGCGAGTAGAAAT-3Â,respec-tively. Plasmid pYLZ-6 was converted to an integrationplasmid,...
  • 8
  • 485
  • 0
The Benefits to Taxpayers from Increases in Students'''' Educational Attainment pot

The Benefits to Taxpayers from Increases in Students'''' Educational Attainment pot

Khoa học xã hội

... that would be incurred over the individ-ual’s lifetime to estimate the benefits to taxpayers of the increase in the individual’s educational attainment. Analytic Approach 19State and Local ... are program participants, we model the logarithm of annual income from the particular program as a function of educational attainment, age, and individual characteristics. Finally we combine ... discount all dollar amounts to 2002 dollars, at an annual rate of 3 percent. We then estimate the net benefit of increased educational attainment to taxpayers in 2002 dollars.Because of data limitations...
  • 143
  • 306
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Discovering the Lexical Features of a Language" pot

Báo cáo khoa học

... diately adjacent words. For a particular word, this information is captured in the set of transitions and transition probabilities going into and out of the state representing the word in the ... similarity requirement is relaxed, this class may expand into the class of all nouns. Once word classes are found, lexical features can be extracted by assuming that there is a feature of the language ... laxed, the class grows to include I, forming the class of singular nominative pronouns. Upon further relax- ation, THEY and WE form a class. Next, (HE, SHE, I) and (THEY, WE) collapse into...
  • 2
  • 299
  • 0
The road to reality   a complete guide to the laws of the universe    penrose, roger

The road to reality a complete guide to the laws of the universe penrose, roger

Vật lý

... became apparent at the head of the beam, giving the whole structure the appearance of a distant giant parasol,glowing evilly, with a smoky Xaming staV. The parasol’s hood began to spread and darken a ... and whatevertheir relations might be to mathematical truth. This realization that the key to the understanding of Nature lay within an unassailable mathematics wasperhaps the Wrst major breakthrough ... those that are objectively true. Indeed, I would regard mathematicalobjectivity as really what mathematical Platonism is all about. To say thatsome mathematical assertion has a Platonic existence...
  • 1,123
  • 542
  • 4
Speedwealth: How to Make a Million in Your Own Business in 3 Years or Less docx

Speedwealth: How to Make a Million in Your Own Business in 3 Years or Less docx

Quản trị kinh doanh

... frominternationally renowned author and speaker, T. Harv Eker. You areencouraged to read and forward this book to anyone you feel mightbe able to use the information in it to help them toward their ... their ownfinancial independence. The conditions for it's redistribution are asfollows:You may not sell this book either digitally or in any printedhard copy format.You must forward this ... class="bi x0 y0 w1 h1" alt=""  Conditional Redistribution RightsWelcome to the best selling book, SpeedWealth™, frominternationally...
  • 104
  • 494
  • 1

Xem thêm