the role of copper as a modifier of lipid metabolism
Investigating the role of menaquinone metabolism in dormant mycobacteria with antisense RNA
... infectious disease of our day High numbers of infections occur all along the equator from Africa over the Middle East to Southeast Asia with China and Russia also sharing a big part of the global TB burden ... 5’ ATGGTACCGTGTCC GAATTGACTGTGCG 3’ 5’ TA GGATCC CCG AAG AAC ACA AAC ACC GC 3’ Amplification of menB (Rv0548c) Amplified region: -101 ; +462 = 563 bp 5’ ATGGTACCTCACGA CCACATGTGACCAAG 3’ 5’ TAGCATGCGACCAGACAAAT ... TAGCATGCGACCAGACAAAT GACCACCTT 3’ Amplification of menC (Rv0553) Amplified region: -112 ; +504 = 616 bp 5’ AT GGTACCAGTACG CGGATATGGTGGTG 3’ 5’ TAGCATGCACAGGGTTGTTC AAGGTATTC 3’ Amplification of...
- 106
- 344
- 0
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... study, there was a significant association of age, grade, lymph node spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an ... years younger than patients without distant metastases (54 years) [p = 0.02] in the IDC group For all invasive carcinomas, the average age of patients with distant metastases was 46 years compared ... of distant metastases in all invasive carcinomas, the subgroup of invasive ductal carcinomas and in the node negative group when cyclin E was stratified as negative and positive (low/high) Many...
- 9
- 423
- 0
Báo cáo khoa học: "The role of cardiac troponin I as a prognosticator in critically ill medical patients: a prospective observational cohort study" ppt
... research, contributed to protocol planning, was a primary data gatherer and drafted the manuscript SC participated in data collection and statistical analysis VN performed statistical analysis ... variables associated with death Variables that were associated with mortality in univariate analysis were considered for inclusion in the model, whereas parameters already incorporated into the ... ventilation, length of stay, and the number of failing organs Statistical analysis Continuous variables' data are expressed as mean value ± SD Bi-variate hypotheses involving continuous variables...
- 6
- 452
- 0
Tài liệu THE ROLE OF UNIVERSITIES IN REGIONAL INNOVATION SYSTEMS - A NORDIC PERSPECTIVE pdf
... evaluations of who was to pay for the clear-up after the environmental disaster Problems arose again in 1997, this time after the national TV channel (DR1) of the Danish Broadcasting Corporation broadcast ... (UHÄ) The location of the general study programmes and the admission capacity of each of these were decided by the Government and Parliament on the basis of material from UHÄ Also, most of the ... The Copenhagen area has seen an actual net influx of inhabitants in the past 10 years after many years of marked “emigration” The change in settlement pattern in the past thirty years is closely...
- 180
- 596
- 1
Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx
... Qualitative data as an attractive nuisance: the problem of analysis Administrative Science Quarterly 24: 590–601 Nonaka I 1994 A dynamic theory of organizational knowledge creation Organization ... instead In the above case, the corporate involvement in terms of stimulating local management was primarily through the award routine The regular financial reporting between general managers and their ... in the way that we have The role of motivation is probably as important in a chain of hotels or supermarkets, a software vendor or a consulting company, regardless of the nature of knowledge The...
- 12
- 514
- 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... National Association of State Public Health Veterinarians Keith A Clark, D.V.M., Ph.D Texas Department of Health Austin, TX National Vaccine Program Anthony Robbins, M.D Office of the Assistant ... College of Chest Physicians University of Alabama at Birmingham Birmingham, AL Wafaa M El-Sadr, M.D., M.P H Infectious Disease Society of America New York, NY Alice Y McIntosh American Lung Association ... regarding the risks and benefits associated with both BCG vaccination and TB preventive therapy They should be informed about a) the variable data regarding the efficacy of BCG vaccination, b) the...
- 27
- 1,309
- 3
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... W168F Y74W CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) ... maintaining the geometry of the active site The availability of crystal structures of TIMs from 21 sources and the large database of TIM sequences from various sources facilitate an analysis of ... (Agilent Technologies, Santa Clara, CA, USA) Nebulization was assisted by N2 gas (99.8%) at a ow rate of 10 Lặmin)1 The spray chamber was held at 300 C The spectrometer was tuned using ve calibration...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... such that either the HA or the HIS epitope tag was added to the end of the ESSS ORF The forward primer was: 5¢-ACga atccGATCTCCGACCCA-3¢; the reverse primer was: 5¢-ATgctagcCTCATCTTCTGGTAACTGG-3¢ ... was used per assay Oxygen consumption was measured polarographically with a Clark oxygen electrode in metabolic chamber with a water jacket maintained at 37 °C (Hansatech, Norfolk, UK) Substrates, ... with HA- or HIStagged hamster ESSS Complex I activity was measured as the malate/glutamate-induced, rotenone-sensitive activity, and the activity of the downstream portions of the electron transport...
- 9
- 622
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... confirmed by DNA sequencing DNA sequencing Plasmid DNA was isolated with the GFXTM Micro Plasmid Prep Kit (Amersham Pharmacia Biotech, Piscataway, NJ, USA), and the resulting dsDNA was mixed with ... the DSC curve The enthalpy change (DHcal) of each protein was calculated by integration of the curve covering area (Tm was taken as the curve peak point) using origin software Acknowledgements ... were purchased from Boehringer (Mannheim, Germany) Ethanol (> 99%) was obtained from Panreac (Barcelona, Spain) Urea was a product of Acros (Pittsburgh, PA, USA) The QuickchangeTM kit containing...
- 7
- 551
- 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline phosphatases at ... higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation of mutant and wild-type...
- 6
- 488
- 0
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf
... have to take into account the evolution of real wages as well as of wage arrears However, a remarkable point is that a substantial proportion of firms (31.5% of the sub-sample) has increased their ... qualitative survey may actually offer a stronger appraisal of their actual behaviors Section two of the paper presents a brief description of the data base and the way it has been used here The third section ... would be a set of given, frozen parameters, rather than adjustment variables on which the managers strategies would actually be able bear Hence the importance of inertial variables, such as past indebtedness...
- 30
- 635
- 0
TMJ Disorders and Orofacial Pain The Role of Dentistry in a Multidisciplinary Diagnostic Approach pptx
... Diagnoses and Classifications Classification of Primary Joint Diseases Classification of Secondary Joint Diseases Hyperplasia, Hypoplasia, and Aplasia of the Condylar Process Hyperplasia of the ... radiograph Mucosal changes 11 Anatomy of the Masticatory System A rational clinical examination of the masticatory system requires a sound basic knowledge of the anatomy As will become clear later ... Mucogingival pain Ostealgia m6 periosteal pain Cutaneous pain jyjpaln Deep pain — Migraine with aura Migraine without aura Cluster headache Paroxysmal unilateral headache Neurovascular variants Arteritis...
- 379
- 1,162
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... pKa calculations pKa values for Asp140, Asp142, Glu144 and Asp215 were calculated in several ChiB mutants as described in Materials and methods (Table 3) Calculations were primarily based on the ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... The pKa of Asp140 is much lower than that of Asp142 and Glu144 in all situations where all three residues are present and the one proton shared by Asp140 and Asp142 appears to remain on Asp142...
- 10
- 651
- 0
MICROECONOMICSPrinciples and AnalysisFrank A. CowellSTICERD and Department of Economics London School of Economics December 2004.ii.ContentsContents List of Tables List of Figures Preface 1 Introduction 1.1 The rôle of microeconomic principles . potx
... standard analytical procedures and simple theorems that can be applied again and again to apparently dissimilar economic problems The student of microeconomics can exploit the fact that many basic ... problems are typically associated with harder mathematics The material in Appendix A is intended to be a statement of fair dealing concerning the technical requirements of the main text: there are ... of the game could refer literally to a game (see chapter 10) but, even in models where game theory makes no formal appearance, the assumptions about the forms of action and interaction that are...
- 668
- 5,134
- 0
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc
... three days later and asked if they had read the instructions (attention) If they had, they were asked a series of questions about information in the handout (recall) and also about what they had ... of the readers, all of whom had gout, as a possible reason for the lack of differences between the groups as well as page layout issues The fifth study, by Morrell et al [33] compared recall of ... novel about asbestos hazards or an NCI asbestos pamphlet were mailed, with an evaluation questionnaire, to a random sample of 500 members of a building trades union There was a 21% response rate...
- 18
- 919
- 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... procedure according to a protocol from the manufacturer GTATTCAAAAGTGGTCCCGGACAAAATGAGGACTTG TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC ... CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG CCTCATTTCCTCCGGGAAGACTTTTGAATAC CGGACAAGGTGAGGACTTGGTACTTACTGGATAC CAAGTCCTCACCTTGTCCGGGAAGACTTTTG Proteases Papain (EC 3.4.22.2) was purified, ... L73G-cystatin A cathepsin B complex was obtained from the analyses of the association kinetics (see above) as the intercept on the ordinate of the plot of kobs,app vs inhibitor concentration and was...
- 10
- 533
- 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
... In all cases, the optimal amount of arachidonic acid was determined and used to analyze the effect of S10 0A8 /A9 on oxidase activation After an incubation of 10 at 20 °C, the oxidase activity was ... an optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from the rate of the superoxide ... NADPH oxidase activity was also assayed by polarographic measurement of the rate of O2 uptake at 20 °C with a Clark electrode at a voltage of 0.8 V All experiments were carried out at least twice...
- 10
- 396
- 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
... define the pulling coordinate for the A and G b-strands as the distance between the first amino acid of strand A (Y9) and the last amino acid of strand G (K87) This distance, x(Y9)ÀxACHTUNGRE(K87), ... unfolding the I27 protein in D2O The pulling coordinate for the separating b-strands is defined as the distance between the first amino acid of strand A (Y9) and the last amino acid of strand G ... G (K87) The elongation of the x(Y9)Àx(87) distance up to the transition state is defined as the distance DxA’ÀG The crossing of the transition state is marked by an abrupt rapid increase in x(Y9)Àx(87)...
- 12
- 553
- 0
Accounting earnings and cash flows as measures of firm performance The role of accounting accruals doc
... (AA) and measures all the adjustments made when using the accrual basis of accounting This is termed ‘aggregate accruals’ in the paper: E - NCF = AA = ACNA - ACL + ALTNA,, - ALTL, - ALTL,, + ALTNA, ... performance declines as the absolute value of aggregate accruals [abs(AA)] increases In this test, all firm-period observations are ranked on the basis of ah(M), quintiles are then formed, and separate ... small and cash flows and earnings are most similar, cash flows are a relatively useful measure of firm performance However, when the magnitude of accruals increases, indicating that the firm has...
- 40
- 354
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008