... Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC 2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC 3 Department of Biochemistry, University of Minnesota College of ... structure-based analysis of staphylococcal nuclease. Proteins: Structure, Function and Genetics 27, 171–183. 15 Flanagan JM, Kataoka M, Fujisawa T & Engelman DM (1993) Mutations can cause large changes ... reported that multiple mutations can cause large changes in the average conformation of denatured proteins. Here we show that a specific single mutation or removal of a specific fragment can cause large...
Ngày tải lên: 20/02/2014, 01:20
... higher value almost 2.5-fold higher than the native cold adapted enzyme (Table 1). The mutant G26 1A/ Y26 9A exhibits an E a almost the same as in the case ofthenativeenzyme(Table1). Thermal inactivation ... gene encoding alkaline phosphatase from the Antarctic strain TAB5 [16]. Based on the crystal structure (at 2.4 A ˚ )ofanEscherichia coli alkaline phospha- tase variant with a 28% amino-acid sequence ... from the Antarctic Table 1. Enzymatic and thermodynamic parameters of the psychrophilic alkaline phosphatase and mutants. Reported values were determined at 10 °C. The k cat values were calculated...
Ngày tải lên: 22/02/2014, 04:20
explain the role of a concept of the american dream plays in act 1 of millers death of a salesman
Ngày tải lên: 21/03/2014, 22:01
Báo cáo y học: "Chronic whiplash and central sensitization; an evaluation of the role of a myofascial trigger points in pain modulation" docx
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "The establishment of a primary spine care practitioner and its benefits to health care reform in the United States" docx
Ngày tải lên: 13/08/2014, 15:21
MICROECONOMICSPrinciples and AnalysisFrank A. CowellSTICERD and Department of Economics London School of Economics December 2004.ii.ContentsContents List of Tables List of Figures Preface 1 Introduction 1.1 The rôle of microeconomic principles . potx
... in the analysis of game-theoretic models (chapter 10) –how one player responds to the actions of another on the assumption of a speci…c form of the rules of the game. We use the comparative statics ... equation: q = F(K; L) (“quantity of output = a function of capital and labour”), which is a convenient way of picking up some of the features that are essential to analysing the behaviour of the ... because the method of proof is not particularly illuminating or is rather technical. Throughout each chapter there are footnotes that focus on detailed points of the argument. These take the...
Ngày tải lên: 08/03/2014, 10:20
Tasks in action in Vietnamese EFL high school classrooms- The role of rehearsal and performance in teaching and learning through oral tasks
Ngày tải lên: 03/03/2015, 09:58
Tài liệu THE ROLE OF UNIVERSITIES IN REGIONAL INNOVATION SYSTEMS - A NORDIC PERSPECTIVE pdf
... Ålborg and Roskilde, together with the expansion of the number of students at the Aarhus School of Busi- ness in the 70s and the 80s, the rate of growth decreased and the number of students was maintained ... of the transistor indicated a spiral model of interac- 50 Since 1970, the State has funded both capital investments and the running of the University of Aarhus in the same way as for the other ... Number of students and teaching staff at University of Aarhus 1980-2002 Source: The University of Aarhus In the same period, there were a number of changes in the admission of stu- dents. Because of...
Ngày tải lên: 16/01/2014, 16:33
Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx
... transfer and the role of motivation in the way that we have. The role of motivation is probably as important in a chain of hotels or super- markets, a software vendor or a consulting com- pany, ... nature of the programme was addressed by many respondents, and it was a par- ticular area where views differed. The programme was designed as a competition, with of cial results and annual award ... programme was managed also differed between plants. The idea of the central programme management was that, at the least, plants should make yearly plans for each machine, outlining performance targets,...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... Public Health Veterinarians Keith A. Clark, D.V.M., Ph.D. Texas Department of Health Austin, TX National Vaccine Program Anthony Robbins, M.D. Office of the Assistant Secretary for Health Washington, ... REPRESENTATIVES John B. Bass, Jr., M.D. American Thoracic Society University of South Alabama Mobile, AL Nancy E. Dunlap, M.D. American College of Chest Physicians University of Alabama at Birmingham Birmingham, ... clinical trials and case-control studies of BCG 2 MMWR April 26, 1996 Other BCG preparations are available for treatment of bladder cancer; these prepara- tions are not intended for use as vaccines. Vaccine...
Ngày tải lên: 15/02/2014, 13:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Genetics Unit, Jawaharlal ... in enzymes: a study of triosephosphate isomerase and comparison with methyl glyoxalsynthase. Adv Protein Chem 66, 315–372. 45 Gunasekaran K, Ramakrishnan C & Balaram P (1996) Disallowed Ramachandran...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... epitope tag was added t o the end of t he ESSS ORF. The forward primer was: 5Â-ACga atccGATCTCCGACCCA-3Â; the reverse primer was: 5Â-ATgctagcCTCATCTTCTGGTAACTGG-3Â. Small bo ld letters refer to the ... antibodies were as follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively. Antibodies ... analyses of the ESSS cDNA in these mutants revealed chain termination mutations. In two of these mutants the protein i s truncated at the C-terminus of the targeting sequence; the m utants are...
Ngày tải lên: 19/02/2014, 16:20
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf
... enterprises, as well as the actual constraints exerted by the structure of a balance sheet are still limited, a qualitative survey may actually offer a stronger appraisal of their actual behaviors. Section ... would have to take into account the evolution of real wages as well as of wage arrears. However, a remarkable point is that a substantial proportion of firms (31.5% of the sub-sample) has increased ... determinants of the probability of making profit, but this would be a set of given, ‘frozen’ parameters, rather than adjustment variables on which the managers’ strategies would actually be able bear....
Ngày tải lên: 06/03/2014, 08:20
TMJ Disorders and Orofacial Pain The Role of Dentistry in a Multidisciplinary Diagnostic Approach pptx
... (Nickel and McLachlan 1994). 38 Function and structural adaptation of the condyle Summary of the basic anatomical and functional changes in the condylar portion of the joint. Increased functional ... Position in the Frontal Plane 217 Attaching the Anatomical Transfer Bow 168 Misinterpretation of the Disk Position in the Sagittal Plane 220 Mounting the Maxillary Cast using the Anatomical 169 ... subchondral cartilage has not yet been affected and would appear in- tact on a radiograph. 35 Buildup of the condylar cartilage Histologically, the secondary cartilage of the condyle is made up of...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... glycosyl- transferase elucidate catalysis in the alpha-amylase family. Nat. Struct. Biol. 6, 432–436. 16. Terwisscha van Scheltinga, A. C., Armand, S., Kalk, K.H., Isogai, A. , Henrissat, B. & Dijkstra, ... However, the mechanistic roles of several of these residues are not described well and there is no example of mutational analysis of all of these residues in the same enzyme. To obtain an insight ... regard to the role of Asp140, whichappearstobecrucialinChiBandinchitinaseA1 from Bacillus circulans, whereas it may be mutated to asparagine without loss of activity in other family 18 chitinases...
Ngày tải lên: 07/03/2014, 14:20
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc
... imbalance, educational imbalance, and where they are fearful of appearing stupid and fearful of rejection or abandonme nt. As a result, they are hesitant to admit that they do not understand ... literacy among medicare enrollees in a managed care organization. JAMA 1999; 281:545–51. [10] International Reading Association, Special Interest group on reading and readability. Newark, Delaware, ... novel about asbestos hazards or an NCI asbestos pamphlet were mailed, with an evaluation questionnaire, to a random sample of 500 members of a building trades union. There was a 21% response rate...
Ngày tải lên: 14/03/2014, 21:20
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGC Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG Reverse CCTCATTTCCTCCGGGAAGACTTTTGAATA ... Mutation Direction Sequence Standard All Forward GCTCAGGCGACCATGGGCCATCATCATC Reverse CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G ... CCTCATTTCCTCCGGGAAGACTTTTGAATA C N77G Forward CGGACAAGGTGAGGACTTGGTACTTACTGGATAC Reverse CAAGTCCTCACCTTGTCCGGGAAGACTTTTG Ó FEBS 2002 Second protease-binding loop of cystatin A (Eur. J. Biochem....
Ngày tải lên: 17/03/2014, 10:20