the road goes ever on and on in elvish

goodwin and seow - 2002 -the influence of cg mechanisms on the quality of financial reporting and auditing in singapore

goodwin and seow - 2002 -the influence of cg mechanisms on the quality of financial reporting and auditing in singapore

... conclusions are drawn, the limitations of the study are noted, and the implications of the findings and further research opportunities are discussed. Jenny Goodwin, Jean Lin Seow / Accounting and Finance ... were told that another international audit firm provided these services The final manipulation concerned the firm auditing all companies in the group In one condition, the firm audited ... focuses on the prevention and detection of weaknesses in internal control Panel A shows that all mean responses are higher for the strong conditions compared to the weak conditions From

Ngày tải lên: 06/01/2015, 19:49

29 456 0
Study on the intestinal absorption of small and oligopeptides in rats (LV thạc sĩ)

Study on the intestinal absorption of small and oligopeptides in rats (LV thạc sĩ)

... Boullin, R.F Crampton, C.E Heading, D Pelling, Intestinal absorption of dipeptides containing glycine, phenyalanine, proline, βalanine or histidine in the rat, Clin Sci Mol Med 45 (1973) 49–58 ... factor-α and interferon-γ increase PepT1 expression and activity in the human colon carcinoma cell line Caco2/bbe and in mouse intestine, Pflügers Arch 452 (2006) 71–80 [83] K Ma, Y Hu, D.E Smith, Influence ... generally consisting to amino acids may elicit bioactivities [4,8] Among them, small peptides showing antihypertensive activity by angiotensin-converting enzyme (ACE) inhibition, renin inhibition, and

Ngày tải lên: 15/01/2018, 11:16

107 228 0
On-the-Causal-Links-Between-FDI-and-Growth-in-Developing-Countries

On-the-Causal-Links-Between-FDI-and-Growth-in-Developing-Countries

... per cent increase in GDP in the long run Given the sampling variation, this corresponds surprisingly well to the impact of a one percentage point increase in the savings rate in a standard Solow ... Copenhagen INTRODUCTION HE inflow of foreign direct investment (FDI) increased rapidly during the late 1980s and the 1990s in almost every region of the world revitalising the long and contentious ... outside the 95 per cent confidence band, while the mean group estimate is well inside the confidence band for Cameroon and Brazil The most interesting information obtained from Figure is the randomness

Ngày tải lên: 30/10/2018, 19:54

21 1 0
Effect of natural pesticide Bordeux mixture on the production of metabolite (EPS and Siderophore) in some PGPBs

Effect of natural pesticide Bordeux mixture on the production of metabolite (EPS and Siderophore) in some PGPBs

... with the standard curve The EPS production before and after the incubation with bordeaux mixture (natural pesticide) and % changing rates in strains are given in Table According to the data obtained ... against high O2 concentration, and participates in bacteria interaction with plants (Leigh and Coplin, 1992; Mandal et al., 2008) Bacterial EPS bind the Na+ ion in the root, through which the ... located in the antagonist mechanism of PGPB, both deprives the pathogen from this element by binding iron and facilitates the use of iron in the plant All organisms need iron, one of the most

Ngày tải lên: 14/01/2020, 09:55

11 67 0
Prognostic model based on the geriatric nutritional risk index and sarcopenia in patients with diffuse large B-cell lymphoma

Prognostic model based on the geriatric nutritional risk index and sarcopenia in patients with diffuse large B-cell lymphoma

... doxorubicin, vincristine, and prednisone (R-CHOP) [1–3] The International Prognostic Index (IPI) and its variations are well-known prognostic markers for DLBCL [4–6]; however, these indices remain ... findings Conclusions Taken together, the data presented here raise the possibility of the GNRI score as a prognostic factor in DLBCL In addition, we found that the combined risk model including ... sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons

Ngày tải lên: 30/05/2020, 21:39

10 31 0
Study on the intestinal absorption of small and oligopeptides in rats

Study on the intestinal absorption of small and oligopeptides in rats

... Boullin, R.F Crampton, C.E Heading, D Pelling, Intestinal absorption of dipeptides containing glycine, phenyalanine, proline, βalanine or histidine in the rat, Clin Sci Mol Med 45 (1973) 49–58 ... factor-α and interferon-γ increase PepT1 expression and activity in the human colon carcinoma cell line Caco2/bbe and in mouse intestine, Pflügers Arch 452 (2006) 71–80 [83] K Ma, Y Hu, D.E Smith, Influence ... generally consisting to amino acids may elicit bioactivities [4,8] Among them, small peptides showing antihypertensive activity by angiotensin-converting enzyme (ACE) inhibition, renin inhibition, and

Ngày tải lên: 28/03/2021, 20:56

107 10 0
Study on the intestinal absorption of small and oligopeptides in rats

Study on the intestinal absorption of small and oligopeptides in rats

... Boullin, R.F Crampton, C.E Heading, D Pelling, Intestinal absorption of dipeptides containing glycine, phenyalanine, proline, βalanine or histidine in the rat, Clin Sci Mol Med 45 (1973) 49–58 ... factor-α and interferon-γ increase PepT1 expression and activity in the human colon carcinoma cell line Caco2/bbe and in mouse intestine, Pflügers Arch 452 (2006) 71–80 [83] K Ma, Y Hu, D.E Smith, Influence ... generally consisting to amino acids may elicit bioactivities [4,8] Among them, small peptides showing antihypertensive activity by angiotensin-converting enzyme (ACE) inhibition, renin inhibition, and

Ngày tải lên: 29/03/2021, 07:15

107 13 0
Leaflet on Breastfeeding Discrimination & Harassment in the Provision of Goods, Facilities and Services & in Other Sectors_Vietnamese

Leaflet on Breastfeeding Discrimination & Harassment in the Provision of Goods, Facilities and Services & in Other Sectors_Vietnamese

... cấp cho phụ nữ tiếp nhận cô làm sinh viên;  cách từ chối cố tình khơng chấp nhận đơn xin nhập học cô với tư cách sinh viên; Trong trường hợp người phụ nữ cho bú sinh viên sở việc sở phân biệt đối ... thành, sinh viên sở đó;  nhân viên sở giáo dục quấy rối phụ nữ muốn trở thành, sinh viên sở đó;  sinh viên sở giáo dục quấy rối phụ nữ muốn trở thành, sinh viên sở đó;  người muốn trở thành, sinh ... bất hợp pháp việc cho bú theo SDO;  Tiến hành kiện tụng chống lại người phân biệt đối xử người khác việc phân biệt đối xử quấy rối cho bú theo SDO;  Đưa chứng thông tin liên quan đến vụ kiện

Ngày tải lên: 08/04/2022, 18:53

10 6 0
meeting the balance of electricity supply and demand in latin america doc

meeting the balance of electricity supply and demand in latin america doc

... and Demand in Latin America and the Caribbean will be higher There would continue to be a decline in the use of petroleum and a slight i tina) and non-hydro renewable © Despite the decline in hydropowers ... billion, the Southern Cone and Mexico USS78 billion each, the Andean Zone US$38 billion, Central America US$25 billion, and the Caribbean USS9 billion * CO, emissions from electricity generation in ... private sector in taking on long-term construction or operation contracts Improvement in the management of social and environmental issues is needed, and the licen ing and commissioning process will

Ngày tải lên: 09/03/2014, 12:20

215 449 0
Bringing in the Excluded? Aesthetic labour, skills and training in the ‘new’ economy doc

Bringing in the Excluded? Aesthetic labour, skills and training in the ‘new’ economy doc

... According to the Scottish Executive (1999) creating and sustaining employability is the responsibility of the state, individuals and training providers. However, in the UK there has been a shifting ... The review of the relationship between aesthetic labour, skills training and Aesthetic Labour, Skills and Training 187 social exclusion provides the context to assess the response of one training ... section of the article considers the skill needs that pertain to aesthetic labour. This discussion then includes a short review of current training provision and social exclusion in relation to the

Ngày tải lên: 23/03/2014, 13:20

20 830 0
The riddim method: aesthetics, practice, and ownership in Jamaican dancehall pdf

The riddim method: aesthetics, practice, and ownership in Jamaican dancehall pdf

... retain the entire original recording, including, in the case of vocal songs, its sung tracks, inserting his own lines in the gaps between the verses of the original. 5 In other cases, the sung ... points into the mic while playing a song, encouraging dancers and ‘bigging up’ himself and the system; in the 1960s, as these interjections – especially as rendered over instrumental recordings ... later in the decade by Lone Ranger and Dillinger. Related to this development was the convention, from around 1970, of having the B-side of a 45 rpm single contain not another song, but an instrumental‘version’

Ngày tải lên: 23/03/2014, 13:20

24 717 0
Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf

Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf

... hydrogen bond between R97 and E399 probably has a strong electrostatic component. However, determination of the relative contribution of each component in this inter- action is not simple. On the other ... the substrate and the arginine residue. Finally, another aspect of the R97 and Y331 influence on catalysis that must be taken into account is the modulation of the ionization state of the catalytic ... mainly by the ionization of the catalytic nucleophile, whereas the catalytic ionization of the proton donor determines the branch above the pH optimum. As the b-glycosidase activity depends on the

Ngày tải lên: 23/03/2014, 15:21

10 522 0
The Assessment of Water Quality and Pollution in Tanzania pptx

The Assessment of Water Quality and Pollution in Tanzania pptx

... monitoring of both pollution inputs and its effects on natural environment. Pollution in Tanzania has yet to reach alarming levels. However, given the continuing population pressure and industrialisation ... quality degradation and their impacts on the natural environment and on human health. Studies have mainly focussed on nutrient loads and distribution, BOD and coliforms levels and other indicators ... pollution such as the dangers of eating contaminated fish and shellfish and swimming in sewage contaminated waters. There is a paucity of information on water quality for a large part of the

Ngày tải lên: 29/03/2014, 21:20

18 553 0
the relationship between old age and poverty in viet nam

the relationship between old age and poverty in viet nam

... and Poverty in Viet Nam Finally, we turn to consider the resulting income distribution for the elderly Figure 23 shows the quintiles of final income for the elderly The inclusion ... in the survey) and this is linked to location and the history of emigration from certain locations in Vietnam during and immediately after the war On average social security and ... Equivalisation of income and. .. coresidence and income pooling Figure 15 shows the income profiles of the elderly according to their household composition, using the same approach and definitions

Ngày tải lên: 27/05/2014, 07:47

44 362 0
Báo cáo sinh học: "Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" pot

Báo cáo sinh học: "Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" pot

... half-life in the blood, low ac cumulatio n in t issues and poor intracellu- lar penetration. Therefore, in preclinical and clinical trials, daily intravenous administration or continuous infusion have ... combination in reducing the expression of the targeted gene (Figure 4C and 4D). Apoptosis and proliferation index in tumors after treatment with G3139 alone or in combination with EP In order ... delivery to tumors and to increase the response of melan oma to therapy. The rationale for the use of G3139 is based on the relevant role of bcl-2 in melanoma cell survival and on the increased sensitivity

Ngày tải lên: 18/06/2014, 22:20

10 483 0
báo cáo hóa học:" Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" ppt

báo cáo hóa học:" Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" ppt

... half-life in the blood, low ac cumulatio n in t issues and poor intracellu- lar penetration. Therefore, in preclinical and clinical trials, daily intravenous administration or continuous infusion have ... combination in reducing the expression of the targeted gene (Figure 4C and 4D). Apoptosis and proliferation index in tumors after treatment with G3139 alone or in combination with EP In order ... delivery to tumors and to increase the response of melan oma to therapy. The rationale for the use of G3139 is based on the relevant role of bcl-2 in melanoma cell survival and on the increased sensitivity

Ngày tải lên: 20/06/2014, 04:20

10 474 0
The Effect of Driving Restrictions on Air Quality in Mexico City pdf

The Effect of Driving Restrictions on Air Quality in Mexico City pdf

... Specifications include weather covariates and indicator variables for month of the year, day of the week and hour of the day, as well as interac- tions between weekends and hour of the day. The R 2 for ... report spending $1,053 in vehicle expenditures annually per vehicle including $625 in vehicle purchases, $288 in maintenance, $83 in insurance, and $57 in licenses and fees. For the increase of ... vehicles that they otherwise would have. This distinction between short- run and long-run adaptation is relevant for interpreting the air qu ality evidence. The impact of driving restrictions on air...

Ngày tải lên: 29/03/2014, 14:20

47 487 0
Rubber in the GMS: An Integrated Research Exercise on Rubber Development in Lao PDR doc

Rubber in the GMS: An Integrated Research Exercise on Rubber Development in Lao PDR doc

... is influencing the Chinese investment in rubber planting in northern of the Lao PDR and is very likely influencing the Vietnamese proposals for rubber plantation expansion in southern of the ... for the group member in planning and management, accounting, and marketing; 5) Increase the role of the production group in the marketing process to reduce the middleman and increase the profit; ... market information and bargaining power. On the other hand, the rubber product marketing in the central part is quite a high price, because they had access to the market information, thus giving...

Ngày tải lên: 31/03/2014, 09:21

79 509 0
Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx

Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx

... (tccgccaccaccaaccactttgtacaagaaagctgggtaxxx-3¢- strand cDNA deleting the stop codon). The vectors pMetY-Cgate and pN-Xgate, yeast strains THY.AP4 and THY.AP5 and the cloning of PCR products by recombina- tional in vivo cloning have been ... Mg 2+ concentrations provokes an increase in ALR1 expression and an enhanced concentration and stability of the protein at the plasma membrane, whereas the addition of Mg 2+ to the growing cells induces ... resuspended and dropped in equal amounts on to plates lacking histidine and adenine with increasing methionine concentrations. (A) Interactions between Alr1–Alr1 pairs, Alr2–Alr2 pairs and Alr1–Alr2...

Ngày tải lên: 19/02/2014, 06:20

14 607 0
w