the rise of a context sensitive rule against bias

Immigration enforcement in the united states: the rise of a formidable machinery potx

Immigration enforcement in the united states: the rise of a formidable machinery potx

... information against immigration, criminal, and terrorism databases Canada also allows nationals of certain countries to travel visa-free 192 DHS, United States-Canada Beyond the Border: A Shared ... 25 Patrol in California, Arizona, New Mexico, and Texas As of May 2011, Operation Phalanx had assisted in the seizure of 14,000 pounds of illegal drugs and the arrest of more than 7,000 illegal ... immigration and federal courts are all manifestations of dramatic growth in immigration enforcement spending and programs I Overall Growth At the time of IRCA’s passage, the Immigration and Naturalization...

Ngày tải lên: 30/03/2014, 22:20

182 369 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...

Ngày tải lên: 25/10/2012, 11:00

6 692 0
Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

... substrate S-2444 and measurement of the increase in absorbance at 405 nm The specific inhibitory activity of PAI-1 was calculated from the amount of PAI-1 that had to be added to inhibit 50% of the ... Mab-1 The EC50 values for binding of each variant to Mab-1 or Mab-2 were determined in parallel with the EC50 value for wt and expressed as a fraction of that The means and standard deviations of ... monoclonal antibody against PAI-1, Mab-2 (Table 1) Mab-2 has an epitope of residues in hF and its flanking sequences [37] Mab-1 protection of PAI-1 against bis-ANS and XR5118 The IC50 values for bis-ANS...

Ngày tải lên: 20/02/2014, 11:20

8 547 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

... pTrc9 9A vector was used for cloning and overexpression of era, encoding the GTPase Era The primers used were as follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT ... 10% of the value The figure is generated by the use of FYTIK software from raw data with a representative gradient profile was a decrease in the total amount of ribosomal particles (30S, 50S, and ... of marker lane products are given in (A) The tables below (A) and (C) show quantification of extension products for each corresponding panel calculated by IMAGE analysis software the strain was...

Ngày tải lên: 06/03/2014, 00:21

12 439 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... Monoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB Analysis of mAbs binding to the recombinant FnBR indicated the generation ... Biorad) was also used to dilute the analyte All of the assays were performed at 25 °C The sensorgrams (time course of the SPR signal in RU) were normalized to a baseline value of All sensorgram ... incubated with rabbit polyclonal antibody against Fn Binding of the polyclonal antibody (B) or mAb (D) to the filters was visualized by addition of HRP-conjugated goat anti-(rabbit IgG) or rabbit anti(mouse...

Ngày tải lên: 06/03/2014, 22:21

16 561 0
By Pike and Dyke: A Tale of the Rise of the Dutch Republic pdf

By Pike and Dyke: A Tale of the Rise of the Dutch Republic pdf

... the Rotherhithe of today It was then a scattered village, inhabited chiefly by a seafaring population It was here that the captains of many of the ships that sailed from the port of London had ... William Martin had purchased on the bank of the river Even a large summer house that stood at the end of the garden was a reproduction of that upon the bank of the canal at home; and when all was completed ... goods as Captain Martin His father had been a trader in the city, but William's tastes lay towards the sea rather than the shop, and as he was the youngest of three brothers he had his way in the...

Ngày tải lên: 08/03/2014, 12:20

186 489 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

... Kennedy and Davis 1993), but gay bars were not always safe or pleasant, and the bars inevitably reached only a small percentage of the local gay and lesbian communities Compared to the gay bar, the ... the ACS) The higher rate of interraciality in HCMST is mainly due to the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and ... Shapley originally imagined mate search as analogous to applying to college The weakness of the analogy is that the set of American colleges is relatively small and stable, and information about most...

Ngày tải lên: 15/03/2014, 21:20

50 470 0
Báo cáo khoa học: "A Context-sensitive, Multi-faceted model of Lexico-Conceptual Affect" pdf

Báo cáo khoa học: "A Context-sensitive, Multi-faceted model of Lexico-Conceptual Affect" pdf

... dimensions as a- labels, and adds a fourth, ambiguous) Esuli & Sebastiani (2007) improve on their affect scores by running a variant of the PageRank algorithm (see also Mihalcea and Tarau, 2004) on the ... Proceedings of LREC-2004, the 4th International Conference on Language Resources and Evaluation, Lisbon, Portugal Hiroya Takamura, Takashi Inui, and Manabu Okumura 2005 Extracting semantic orientation of ... is propagated from rollercoasters to amusement parks) so that the implicit affect of many other concepts can be determined Strapparava and Valitutti (2004) provide a set of affective annotations...

Ngày tải lên: 30/03/2014, 17:20

5 180 0
the rise of modern philosophy a new history of western philosophy volume 3 sep 2006

the rise of modern philosophy a new history of western philosophy volume 3 sep 2006

... camps First, he was an unpaid volunteer in the army of the Protestant Prince of Orange; later he served in the army of the Catholic Duke Maximilian of Bavaria, who was then at war with the Palatine ... 1511 can well be regarded as the high point of the Renaissance In the Vatican Raphael was frescoing the walls of the papal apartments, while Michelangelo covered the ceiling of the Sistine Chapel ... cats and cabbages—did at least have the advantage of undoubted existence in the everyday world, unlike unknowable substrata, monads, noumena, and the Absolute On the other hand, thinkers of a more...

Ngày tải lên: 11/06/2014, 10:31

371 469 0
báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx

báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx

... were as follow: ABCC2 forward: 5'-CTC ACTTCAGCGAGACCG-3'; ABCC2 reverse: 5'-CCAGCCAGTTCAGGGTTT-3'; ACTB forward: 5'-CACCCAGCACAATGAAGAT-3'; ACTB reverse: 5'-CA AATAAAGCCATGCCAAT-3' Cycling conditions ... siRNA increased the intracellular accumulation of cisplatin ABCC2 ABCC2 siRNA increased the intracellular accumulation of cisplatin (A) A typical chromatogram for total analysis of cisplatin ... Wada M, Kohno K, Nakamura T, Kawabe T, Kawakami M, Kagotani K, Okumura K, Akiyama S, Kuwano M: A human canalicular multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplatin-resistant...

Ngày tải lên: 18/06/2014, 15:20

9 510 0
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf

Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf

... in analyses and interpretation of data He drafted the manuscript AG has been involved in analyses and interpretation of data and statistical analysis She helped to draft the manuscript RC participated ... immunohistochemistry as described previously [20] A digital camera (Olympus, Tokyo, Japan) was used to capture images of the plaques at an × magnification The binding of anti-Ab sera to the b-amyloid plaques was ... observed for a long period of time, the chance that the dual vaccine is safe is very high Finally, we think that the availability of a safe dual vaccine will allow the treatment of pre-symptomatic people...

Ngày tải lên: 18/06/2014, 22:20

15 431 0
Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

... by the American Foundation for AIDS Research (amfAR) Grant 02882-32-RGV, National Institutes of Health Grant AI054183 to R.M.R, National Institutes of Health Grant AI078779 to F.R.F and National ... Directed antigen delivery as a vaccine strategy for an intracellular bacterial pathogen Proc Natl Acad Sci USA 2006, 103:5102-5107 10 Roberts DM, Nanda A, Havenga MJ, Abbink P, Lynch DM, Ewald BA, ... in parentheses for each group All Lmdd-gag vaccinations were preceded by oral administration of saturated sodium bicarbonate D-ala (640 mg/kg) was co-administered intravenously before and after...

Ngày tải lên: 11/08/2014, 08:21

7 394 0
Báo cáo y học: " A study of the effectiveness of telepsychiatrybased culturally sensitive collaborative treatment of depressed Chinese Americans" pptx

Báo cáo y học: " A study of the effectiveness of telepsychiatrybased culturally sensitive collaborative treatment of depressed Chinese Americans" pptx

... satisfaction with their depression treatment when they are receiving collaborative care management [15] Collaborative care management is ideal for patients whose grasp of the American healthcare ... Pharmaceuticals, Inc.; Somerset Pharmaceuticals, Inc.; Sunovion Pharmaceuticals; Synthelabo; Takeda Pharmaceutical Company Limited; Tetragenex Pharmaceuticals, Inc.; TransForm Pharmaceuticals, ... intervention may significantly increase the accessibility of mental health services to immigrant populations The collaborative care management model may help these populations navigate the healthcare system...

Ngày tải lên: 11/08/2014, 16:20

8 453 0
báo cáo khoa học: " The rise of injecting drug use in east Africa: a case study from Kenya" ppsx

báo cáo khoa học: " The rise of injecting drug use in east Africa: a case study from Kenya" ppsx

... es Salaam, than at the Kenyan Coast The recent study from Dar es Salaam, Tanzania [7] indicates that injecting drug use is widespread in the Tanzanian capital Similarly, the 2001 assessment of ... was an average obtained from rural and urban areas within the district In 2001 local health officials estimated that the HIV prevalence rate in the town was approximately 20% It appears that the ... that she should be a participant rather than a mere observer of heroin or any other drug use As a woman in her forties SB was the same age as the parents of many of the users Crucially, certain...

Ngày tải lên: 11/08/2014, 20:20

9 319 0
Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx

Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx

... ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 Negative sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive ... CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA Negative sense-specific QPCR primer FAM-TTGGTATAGCACAATCTTCTACCAGAGGTGGC-TAMRA Sequence contains an EcoRI ... than the cotton rat [19], constitutes a more practical model due to the availability of a larger number of immunological and molecular reagents as well as the availability of transgenic animals...

Ngày tải lên: 12/08/2014, 01:22

11 348 0
Báo cáo y học: " Construction of doxycyline-dependent mini-HIV-1 variants for the development of a virotherapy against leukemias" pps

Báo cáo y học: " Construction of doxycyline-dependent mini-HIV-1 variants for the development of a virotherapy against leukemias" pps

... AAA GGA CCA GCA AAG CTC CTC TGG AAA GGT 3') and WS3 (5'TAG AAT TCA AAC TAG GGT ATT TGA CTA AT) The same PCR was performed on DNA from a vpU-deletion construct [pDR2484, [39]] The PCR fragments ... (vpU startcodon inactivation) and rtTAΔ6B (vpU deletion) As part of the vpU inactivation strategy, the Y2 6A inactivating mutation in the tat gene of HIV-rtTA is replaced by the wt tat gene of the ... left panel) Surprisingly, replication of the minimized rtTAΔ 6A and rtTAΔ6B variants is significantly faster than that of the parental HIV-rtTA virus and even faster than the wild type LAI virus...

Ngày tải lên: 13/08/2014, 09:20

12 318 0
Bóa cáo y học: "Is the value of a life or life-year saved context specific? Further evidence from a discrete choice experiment" ppt

Bóa cáo y học: "Is the value of a life or life-year saved context specific? Further evidence from a discrete choice experiment" ppt

... 3201.0) Canberra: Commonwealth of Australia; 2005 ABS: Australian Bureau of Statistics (ABS) Life Tables, Victoria 2002–2004 (Catalogue No 3302.2.55.001) Canberra: Commonwealth of Australia; 2005 ... (ABS) Census of Population and Housing 2001, Basic Community Profile (Catalogue No 2001.0) Canberra: Commonwealth of Australia; 2002 ABS: Australian Bureau of Statistics (ABS) National Health Survey ... pay for saving the life of a 18 year old with a life-expectancy averaging a further 63.5 years in the Australian population [38,39] is estimated at AUD702,223 Willingness to pay for saving the...

Ngày tải lên: 13/08/2014, 11:22

15 363 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...

Ngày tải lên: 12/09/2012, 15:05

23 1,3K 1
List the components of a radio system

List the components of a radio system

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...

Ngày tải lên: 13/09/2012, 10:52

30 922 0
w