the relational operators return a boolean value depending on the comparison being made
Báo cáo hóa học: " On the solvability of a boundary value problem on the real line" pdf
Ngày tải lên :
20/06/2014, 22:20
... required assumptions Similar considerations can be done for the p-Laplacian operator too, using Theorem 2.5 Author details Dipartimento di Matematica - Università di Bologna, Piazza di Porta S.Donato ... here on, the proof proceeds in the same way □ In the particular case of p-Laplacian operators, one can use the positive homogeneity for weakening assumption (2.17) of Theorem 2.4 and widening the ... implies the validity of the analogous condition with g > 1, assumed in [11] (see condition (8)) But, on the other hand, taking g > one can lose the summability of the function KC required in assumption...
- 17
- 409
- 0
Procedural Abstraction and Functions That Return a Value
Ngày tải lên :
12/09/2012, 22:48
... function call Returns the value calculated by the function Syntax: return expression; expression performs the calculation or expression is a variable containing the calculated value Example: return ... as a single function because Subtask and subtask are identical tasks The calculation for subtask is the same as the calculation for subtask with different arguments Subtask and subtask each ... formal parameter, the second argument for the second formal parameter, and so forth The value plugged into the formal parameter is used in all instances of the formal parameter in the function body...
- 94
- 541
- 0
Báo cáo vật lý: "THE COVARIABILITY BETWEEN ANOMALOUS NORTHEAST MONSOON RAINFALL IN MALAYSIA AND SEA SURFACE TEMPERATURE IN INDIAN-PACIFIC SECTOR: A SINGULAR VALUE DECOMPOSITION ANALYSIS APPROACH" pdf
Ngày tải lên :
07/08/2014, 14:20
... analyze the covariability between the anomalous northeast monsoon (NEM) rainfall anomaly in Malaysia and the large-scale sea surface temperature (SST) anomaly in Indian Ocean, Pacific Ocean and ... at station i (8) The Covariability Between Anomalous Northeast Monsoon 106 For convenience, the rainfall time series in each station are arranged in the rows of the data matrix according to the ... However, the strong ENSO-Malaysian rainfall relationship during the NEM period is only apparent in East Malaysia [9] Juneng and Tangang [9] attributed this to the seasonal migration of ENSO signal...
- 15
- 295
- 0
Báo cáo y học: "Does serum procalcitonin have a diagnostic value in febrile adult patients presenting to the emergency department" potx
Ngày tải lên :
13/08/2014, 08:21
... that, in contrast to the etiological diagnosis of the emergency physician found in the medical chart, we observed that administration of antibiotics was not always in accordance with that diagnosis, ... adverse postoperative outcome after cardiac surgery A comparative study between coronary artery bypass graft, valve, and combined cardiac surgery Crit Care 2007, 11:R106 Christ-Crain M, Jaccard-Stolz ... chirurgie aortique abdominale Ann Fr Anesth Réanim 2007, 26:R460 Fellahi JL, Hedoire F, Le Manach Y, Monier E, Guillou L, Riou B Determination of the threshold of cardiac troponin I associated with an...
- 2
- 260
- 0
A STUDY ON THE LOGICAL ERRORS MADE BY THIRD YEARS ENGLISH MAJORS AT HAIPHONG PRIVATE UNIVERSITY
Ngày tải lên :
11/12/2013, 23:53
... second one is just the paraphrase of the first one and hence no further information is generated to strengthen the argument In addition, one half of the conclusion also repeats the idea mentioned ... in the living standard but the maximum decrease in emotional values There are a number of reasons for great emotional gap among people One of them is because of technology that people especially ... reasons, Hasty generalization, Circular reasoning , Wrong conclusion are the ones coinciding with the researcher prediction whereas, the rest are even not dealt with in the literature Now, the...
- 73
- 617
- 0
Tài liệu Retrieving a Single Value from a Query pdf
Ngày tải lên :
14/12/2013, 18:16
... The ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance ... performance improvement when compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore ... improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the result...
- 2
- 312
- 0
An investigation into the effects of brainstorming and giving a text as model on phan dinh phung high school student's attitude and writing ability
Ngày tải lên :
18/12/2013, 10:08
... model Tables 10: The reasons for the approval the application of giving a text as a model in the future Table 11: The reasons for the disapproval of application of giving a text as a model in the ... ways 10 Having a range of vocabulary As can be seen from the diagram above, ideas and a range of vocabulary are always demonstrated by writers If writers have poor ideas and vocabulary for their ... the activities Teachers feed back about classs discussion on choosing ideas, students reading a model and vocabulary and organization Actual writing task analyzing the model Actual writing task...
- 60
- 717
- 0
Reliability analysis of a power system based on the multi state system theory
Ngày tải lên :
03/01/2014, 19:38
... the capacity of the system is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh and the capacity ... of other branches are all above 5800 mAh, the system is reliable because the required capacity is reached But when we analyze the system reliability using the traditional system reliability theory, ... theory are always conservative For example, when the required capacity is 23.4 Ah, the reliability of the system obtained by the traditional system reliability theory is only 0.25107, but the reliability...
- 4
- 407
- 0
Tài liệu Reading a Column Value Using Strongly Typed DataSet Classes pptx
Ngày tải lên :
21/01/2014, 07:20
... System.Data.SqlClient.SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; MyDataSet myDataSet = new MyDataSet(); sqlConnection1.Open(); mySqlDataAdapter.Fill(myDataSet, "Customers"); sqlConnection1.Close(); ... can also create a strongly typed DataTable table object using the MyDataSet.CustomersDataTable class and populate it with rows from the Customers table For example, you can set the Form1_Load() ... table Using a Strongly Typed DataSet Class Once you have your strongly typed MyDataSet class, you can create an object of that class using the following code: MyDataSet myDataSet = new MyDataSet();...
- 7
- 288
- 0
Tài liệu Getting a Sequence Value from Oracle pdf
Ngày tải lên :
21/01/2014, 11:20
... and caching can be specified when creating the sequence Oracle stores the definition of sequences for a database in a single data dictionary table in the SYSTEM table namespace As a result, all ... CommandType.StoredProcedure; // Add the parameters and set values for them cmd.Parameters.Add(ID_PARM, OracleType.Int32).Direction = ParameterDirection.Output; cmd.Parameters.Add(FIELD1_PARM, OracleType.NVarChar, 50); ... generator can generate unique values for more than one table The SQL command CREATE SEQUENCE is used to create a new sequence as shown in the previous sample The increment, start value, maximum value, ...
- 4
- 338
- 0
Tài liệu Determinants of Productivity for Military Personnel - A Review of Findings on the Contribution of Experience, Training, and Aptitude to Military Performance pdf
Ngày tải lên :
17/02/2014, 22:20
... technician; ”technical” positions, including aviation machinist’s mate, aviation structural mechanic, aviation ordnanceman, aviation equipment support technician, and aviation survival equipmentman; ... relationships between AFQT and years of experience or additional training are linear Rather, the authors note that although the magnitude of the trade-off may vary, it is at least one-to-one and ... training/development, and recruitment and retention programs of the armed forces Accurate data on the relationship between performance on the one hand and ability, experience, and training on the other would allow...
- 87
- 627
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
Ngày tải lên :
18/02/2014, 11:20
... Restriction site W11F W168F WT* Y74W* WT WT W11F WT* W11F W168F W11F W168F W11F W168F Y74W CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... melting and precipitates at 58 C Table provides a comparison of the denaturation parameters of PfTIM wild-type and the Y74W* triple mutant For comparison, the measured parameters for the double mutant...
- 15
- 635
- 0
A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf
Ngày tải lên :
06/03/2014, 13:20
... the connotation of a relative name? The attribute signified by a relative name, say some, is a relation; and this they give, if not as a sufficient explanation, at least as the only one attainable ... simultaneously; since the meaning of the name itself imports (among other things) that there can be only one such person at a time This being the case, and the application of the name being afterward ... be said to connote the sameattribute: to be a father, is not the same thing as to be a son But when we call one man a father, another a son, what we mean to affirm is a set of facts, which are...
- 1K
- 548
- 0
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc
Ngày tải lên :
14/03/2014, 21:20
... phone three days later and asked if they had read the instructions (attention) If they had, they were asked a series of questions about information in the handout (recall) and also about what they ... accompanied by a drawing showing a person carrying out that action along with a caption written at a second grade reading level As a result, people who can understand writing at a second grade ... their evaluations of health education materials, questions on whether the materials were read or attended to by patients and their family care givers and investigate the kinds of pictures that...
- 18
- 919
- 0
Báo cáo khoa học: Tumour necrosis factor-a attenuates insulin action on phosphoenolpyruvate carboxykinase gene expression and gluconeogenesis by altering the cellular localization of Foxa2 in HepG2 cells pptx
Ngày tải lên :
16/03/2014, 02:20
... rRNA was taken as the internal loading control (A) Each band was analysed densitometrically and the values are depicted after normalization of PEPCK and G6Pase bands with those of 18S rRNA (B) ... transcript was quantified by the relative standard curve method and normalized to that of 18S rRNA The transcript value for the control obtained after normalization was arbitrarily assigned a value of ... analysis Each band, when mentioned, was analysed by alpha digidoc 1201 software (Alpha Innotech Corporation, San Leandro, CA, USA) The same sized rectangular box was drawn surrounding each band...
- 13
- 449
- 0
One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires
Ngày tải lên :
16/03/2014, 15:35
... adsorbed on the clean Ag areas are not ordered according to the same structure as that observed upon adsorption on a clean Ag(1 0) surface [10] The reactivity of the Ag surface is presumably locally ... day after the evaporation of THAP on the surface exhibit the same random adsorption of the THAP molecules on the surface This suggests that even after a significant amount of time for diffusion ... al [2] and (b) side view of the PQ/SiNWs adsorption mechanism responsible for the shrinkage of the gap For the same reason, the onset of the feature appearing at À0.5 V is presumably due to the...
- 5
- 465
- 0