the presence of a single tyrosine residue rescues d6 activity
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
Ngày tải lên :
07/03/2014, 12:20
... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A ... (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...
- 11
- 548
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
Ngày tải lên :
08/03/2014, 09:20
... Gly)10 residue into pC4Meth94PhoE, the EcoRI/BamHI fragment of the plasmid was replaced by PCR fragments created using the PhoE forward primer (5¢-GCCGGAATTCTAATATGAAAAAGAGCACTCT GGC-3¢) and the ... PhosphorImager 473 (Molecular Dynamics) and quantified using the Imagequant software (Molecular Dynamics) To test the targeting of wild-type prePhoE RNCs, truncated mRNAs were translated in the presence ... [13] Quantification of the data indicated that the cross-linking efficiency of the mutant nascent chains was somewhat reduced (Fig 3B) In conclusion, our results show an increased affinity of the G-10C...
- 8
- 546
- 0
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx
Ngày tải lên :
23/03/2014, 13:20
... the appearance of trypsin activity showed a typical sigmoidal curve After an initial lag period, a rapid increase in trypsin activity was observed The lag phase of the S-shaped activation curve ... in each case As the autocatalytic activation of trypsinogen is quantitative, the increase in trypsin activity shows the appearance of newly processed trypsin during the reaction, and the y scale ... for acceleration of the activation process [31] Desnuelle & Gabeloteau showed that in the presence of calcium ions the autocatalytic activation of trypsinogen is quantitative and therefore calcium...
- 8
- 403
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
Ngày tải lên :
18/06/2014, 22:20
... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed...
- 5
- 483
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
Ngày tải lên :
20/06/2014, 04:20
... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed...
- 5
- 430
- 0
báo cáo hóa học: " Topological confinement in an antisymmetric potential in bilayer graphene in the presence of a magnetic field" pptx
Ngày tải lên :
21/06/2014, 02:20
... perpendicular external magnetic field, both for the case of a single potential kink, as well as for a kink-antikink pair One advantage of such a setup is the fact that in an experimental realization of ... to the states that are indicated by arrows in panel (a) (a) (b) Figure Energy levels of a single kink profile in bilayer graphene as function of external magnetic field B0 with the same parameters ... the sequence alignment and drafted the manuscript GAF contributed in analysis of the numerical results All authors read and approved the final manuscript Competing interests The authors declare...
- 10
- 471
- 0
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc
Ngày tải lên :
22/06/2014, 00:20
... adsorbed by H The charge around the H atom at the Si adatom removes toward the adsorbed Ag atom and forms a covalent-like Ag-H bond Due to the charge transfer from the H to the Si adatom on the ... calculating the total energy of the system including full relaxation of all Si atoms and H atoms (except for the bottom hydrogenated Si atoms) and the Ag adatom The adsorption energies (Ead) are ... influences of H on the Ag adsorption at a Si(111)-7 surface, we first calculate the adsorption energies of Ag atom at the high coordination sites on the clear and 19H-Si(111)-7 surfaces, because all the...
- 6
- 368
- 0
báo cáo khoa học: " The presence of a lipoma in the Eustachian tube: a case report" pdf
Ngày tải lên :
10/08/2014, 23:20
... Int J Pediatr Otorhinolaryngol 1993, 25(1-3):183-189 Tanaka H, Kohno A, Gomi N, Matsueda K, Mitani H, Kawabata K, Yamamoto N: Malignant mucosal melanoma of the eustachian tube Radiat Med 2008, ... a soft consistency and had the gross appearance of adipose tissue Histological examination confirmed the diagnosis of fibrolipoma (Figure 3) Our patient was discharged the day after surgery and ... the surgery and helped in preparation of the final manuscript QL did the endoscopic examination and postoperative follow-up of our patient All authors read and approved the final manuscript Submit...
- 3
- 336
- 0
báo cáo khoa học: " Peritonitis secondary to traumatic duodenal laceration in the presence of a large pancreatic pseudocyst: a case report" ppsx
Ngày tải lên :
10/08/2014, 23:20
... and amended the manuscript LCT provided the photographs obtained at the time of surgery All authors read and approved the final manuscript Competing interests The authors declare that they have ... fashion an antecolic gastrojejunostomy to the anterior gastrostomy (Figure 3) to ensure drainage from his stomach His abdominal cavity was lavaged with copious warm saline, a drain placed adjacent ... the gastrojejunostomy and a drain by the duodenal repair and his abdomen closed The drains were necessary due to the widespread peritoneal contaminations found during the laparotomy He made an...
- 4
- 251
- 0
ON THE HALL EFFECT IN PARABOLIC QUANTUM WELLS WITH AN IN PLANE MAGNETIC FIELD IN THE PRESENCE OF a STRONG ELECTROMAGNETIC WAVE (LASER RADIATION)
Ngày tải lên :
31/10/2015, 10:41
... taking account of arbitrary transitions between the Landau levels The analytical result is numerically evaluated and graphed for a specific quantum well, GaAs/AlGaAs, to show clearly the dependence ... values of the HC at the maxima are much larger than other values By using the computational program we easily determine the position of the peak in each curve All the peaks correspond to the ωc2 ... electrons in the single (constant) scattering time approximation Then utilizing the similar way as in Ref [14] and performing the analytical calculation for the total current density we have the expression...
- 7
- 317
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
Ngày tải lên :
14/02/2014, 19:20
... of 50 lm dopamine on the aggregation process Dopamine delayed the lag phase of aggregation marginally to 95.5 h from 86.8 h in the presence of MPTP alone The apparent rate constant of aggregation ... substantia nigra is a neuropathological hallmark of Parkinson’s disease This leads to a decreased level of dopamine in the striatum As a result, synaptic transmission is negatively affected in a- synuclein ... that the protective action of rasagiline, a MAO-B inhibitor, on the aggregation of a- synuclein, is because of its action as a free radical scavenger [36] Thus, it may be speculated that dopamine...
- 11
- 754
- 0
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc
Ngày tải lên :
19/02/2014, 16:20
... formed The anchoring of a- carboxylate and a- amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino acid The lability of the a- proton ... comparison of the rates of formal ÔreprotonationÕ (kr) for the normal and a- deuterated substrates in D2O allowed us to establish if there was any internal return of the a- proton after its abstraction ... 754 and treated as above The theoretical values of isotopic exchange rates were calculated, based on the assumption that the number of operative active sites participating in reactions of SOPC decomposition...
- 7
- 532
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
Ngày tải lên :
20/02/2014, 01:20
... average conformation of denatured proteins Here we show that a specific single mutation or removal of a specific fragment can cause large changes in the native state of SNase Fig Steady-state fluorescent ... is partially supported by a grant (NSC92-2311-B-001) from the National Science Council, Taiwan, R.O.C and the theme project of Academia Sinica, Taipei, Taiwan, R.O.C 3965 Staphylococcal nuclease ... 50 mm NaHPO4 ⁄ 200 mm NaCl, pH adjusted to 7.0) at a concentration of 0.5 mgÆmL)1 Spectra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20...
- 7
- 551
- 0
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
Ngày tải lên :
21/02/2014, 00:20
... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... not mark any as poor or inappropriate Another structural analysis, obtained by the VERIFY3D program [61], gave an average value of 0.21, which is greater than zero, the quality value indicated ... the program In addition, the distribution of distances between conserved residues and between all the residues was calculated, as was the Xd parameter (Materials and methods) [62] The value of...
- 12
- 550
- 0
Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127
Ngày tải lên :
19/03/2014, 16:48
... 106:1878 doi:10.1021/jp015532w 26 Hashimotoa H, Yokoyamab S, Asaokaa H, Kusanoc Y, Ikedad Y, Senoe M, Takadaa J, Fujiia T, Nakanishia M, Murakami R (2007) J Magn Magn Mater 310:2405 doi:10.1016/j.jmmm.2006.10.793 ... of the samples prepared in alcohol/water media with various volume ratios of alcohol to water: (a) 0:1, (b) 1:1, (c) 5:1 Fig TEM images of the samples prepared in alcohol/ water media with various ... in pure water and in alcohol/water media is also investigated, as shown in Fig The value of saturation magnetization of samples a, b, and c is 75.4 emu/g (Fig 3a) , 39.2 emu/g (Fig 3b), and (Fig...
- 4
- 658
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
Ngày tải lên :
23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx
Ngày tải lên :
24/03/2014, 00:21
... which are in the normal range for thermophilic F1-ATPase activity ATP hydrolysis assay ATP hydrolysis was measured using an ATP-regenerating system as a decrease in A3 40 of NADH at 25 °C The assay ... inhibits ATPase activity, particularly at low ATP concentrations We then compared the initial ATPase activity of the a( W463F)3b(Y341W)3c complex in the presence and absence of 20 mM Pi Although there ... line was drawn by ®tting the equation (a + b[Pi])/(Kd + [Pi]) to the data points Here, a is the residual ATPase activity at 1.2 lM ADP in the absence of Pi, and b is the maximum activity regained...
- 8
- 443
- 0
Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx
Ngày tải lên :
24/03/2014, 03:20
... explore these parameters in detail Second, we plan to appreciably enhance the integrated model It appears from both our initial data analysis, as well as our qualitative examination of the data, that ... information could enable agents to emulate many elements of more natural and realistic human conversational behavior A computational model may also make valuable contributions to research in the area ... model of how collaborative pairs adapt their language in the presence (or absence) of shared visual information A successful computational model of referring behavior in the presence of visual information...
- 8
- 567
- 0
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
Ngày tải lên :
24/03/2014, 04:21
... -glyceraldehyde-3-phosphate (GraP ) The reaction was started by the addition of an appropriate amount of a solution of GraP containing the requisite amount (0.5 mmol) of GraP The aqueous solution of ... GraP was prepared from the water insuluble barium salt of D ,L -glyceraldehyde3-phosphate diethylacetal and the amount of GraP present was measured enzymatically [10] The enzyme was also assayed ... for inactivation If we assume that all the n modifiable residues including essential residue( s) are approximately equally reactive towards the reagent and modification of any of the essential residue( s)...
- 8
- 283
- 0
Báo cáo "Thermomechanical characteristics of rigid poly(vinyl chloride) crosslinked by a peroxide in the presence of trimethylolpropane trimethacrylate " pdf
Ngày tải lên :
03/04/2014, 15:20
... samples This is explained by the crosslinking PVC in the presence of DAPC and TMPTMA as mentioned above At any concentration of TMPTMA, a maximum of the PVC samples also appears at 0.4 phr of ... temperature to 210oC in air A range of loads (0.01 - 0.1 N) on the probe is investigated Plots of probe penetration of the above samples are automatically recorded Thermomechanical characteristics ... Thermomechanical analysis A thermomechanical analyzer (Mettler TA4000, Switzerland) with a flat-ended, loaded probe (dia mm) is used for thermomechanical analysis PVC samples are heated at 10oC/min...
- 5
- 377
- 0