the oxidation of metals and alloys at high temperatures
High Temperature Strain of Metals and Alloys Part 1 ppt
... mechanisms of the high- temperature deformation of pure metals and solid solutions are worked out on the basis of the obtained data The quantitative model of creep is considered and validated Equations ... Peculiarities of High- temperature Deformation 40 Summary 41 Physical Mechanism of Strain at High Temperatures Physical Model and Theory 43 Velocity of Dislocations 45 Dislocation Density 49 Rate of the ... Effect of Orientation on Properties 111 Deformation at Lower Temperatures 116 Deformation at Higher Temperatures 124 On the Composition of Superalloys 129 Rafting 130 Effect of Composition and Temperature...
- 15
- 303
- 0
High Temperature Strain of Metals and Alloys Part 2 pptx
... amplitudes of the atomic oscillations the smaller is the diffusion mobility of the atoms and the greater the resistance to applied stresses Therefore measurements of amplitudes of atomic oscillations ... motion of atoms has a great influence on the interference pattern The intensity of the scattering of the X-rays by a group of atoms subjected to independent heat vibrations is weakened by the factor ... angle ω of the crystal rotation and the two angles, 2θ and ψ, of the detector motion Angles ω and 2θ are measured in the equatorial (horizontal) plane of the goniometer and angle ψ in the meridianal...
- 15
- 269
- 0
High Temperature Strain of Metals and Alloys Part 3 pdf
... features of strain (creep) at high temperatures and it turns out that these features are caused by a certain physical mechanism The first distinctive feature is the simultaneous formation of ... other The following conclusion look obvious: it is the process of substructure formation that is the cause of the decrease in the plastic strain rate The subgrain dimensions are of the order of ... Fig 3.14 and in other areas marked with the letter j These kinks at mobile dislocations turn out to be of great importance for our understanding of the physical mechanism of the steady-state creep...
- 15
- 321
- 0
High Temperature Strain of Metals and Alloys Part 4 ppsx
... Physical Mechanism of Strain at High Temperatures where ρm is the rate of the density increase due to the dislocation multipli˙d cation, ρm is the rate of the density change on account of the sub-boundary ... 4.10) The amplitudes of atomic vibrations correlate with one of the main characteristics of the high- temperature strength – the rate of the stationary creep One can see in Fig 4.10 that the creep ... 4.4 Rate of the Steady-State Creep state strain rates at the test temperatures 673, 873, and 1023K When the temperature is increased to 1173K the theoretical model fails Fig 4.7 The steady-state...
- 15
- 254
- 0
High Temperature Strain of Metals and Alloys Part 5 pdf
... Most heat-resistant metals, steels and alloys operate at temperatures between 0.40 and 0.75 Tm The area of temperature and stress where the proposed mechanism of hightemperature deformation takes ... amplitude of atomic vibrations at high temperatures The developed theory is valid within certain limits of the temperature and applied stress When the temperature is relatively low, the dislocation ... measured The quantitative evaluation of the strain rate was out of the question at that time, of course As a matter of fact, the adjacent jogs of opposite signs slip along the dislocation line...
- 15
- 409
- 0
High Temperature Strain of Metals and Alloys Part 6 doc
... generation and of the dislocation annihilation (immobilization) are equal The sum of the positive terms on the right-hand side of Eq (5.3) is equal to the sum of the absolute values of the negative ... aluminum are placed at the vertices of the cubic cell and form the sublattice A Atoms of nickel are located at the centers of the faces and form the sublattice B In fact the phase is not strictly ... deformation the rates of the dislocation generation and annihilation seem to be equal and the parameters λ and D are constant Thus, we should solve the system of equations to calculate the density...
- 15
- 265
- 0
High Temperature Strain of Metals and Alloys Part 7 pot
... heat-induced atomic vibrations and the forces of interatomic bonds in the crystal lattice of the hardening γ phase It seems natural that the greater the vibration amplitude the greater ... diagonal [10¯ atoms of 1] aluminum and nickel are altered Atoms of Ni that are denoted as and of Al that are denoted as are located in the first slip plane Atoms of Ni and of Al are located in the second ... 2l The value of ∆U in Eq (6.8) is close to the activation energy of generation and migration of vacancies in the ordered phase The sum of these values is known to be the energy activation of...
- 15
- 281
- 0
High Temperature Strain of Metals and Alloys Part 8 docx
... significantly in the aluminum sublattice We have compared the mean-square atomic amplitudes in strengthening phases of superalloys with the rate of the steady-state creep ε of the same ˙ alloys The superalloy ... 50–80 pm2 at 1023K The smaller the mean-square amplitudes of the atom vibrations in the hardening phase the higher the creep strength of a superalloy Methods of prediction of the properties of new ... 110 High- temperature Deformation of Superalloys In a phase of type B3 A (Ni3 Al) Ti atoms occupy places in sublattice A Cr, Fe and Co atoms are located mostly in sublattice B Atoms of Mo, Nb and...
- 15
- 340
- 0
High Temperature Strain of Metals and Alloys Part 9 potx
... Deformation at Lower Temperatures Fig 7.7 The orientation of the CMSX-4 superalloy specimens within the stereographic triangle The effect of misorientation on the behavior of specimens at lower temperatures ... temperatures is very strong The authors noted that the magnitude of the steady-state creep rate correlates with the maximum rate in the primary creep stage The further from the < 001 > orientation ... in terminating the primary creep Thus, the primary creep at lower temperatures starts with the propagation of a/2 < 110 > dislocations through the γ channels The sources of these dislocations supposedly...
- 15
- 239
- 0
High Temperature Strain of Metals and Alloys Part 11 docx
... a coating The minimum strain rate of niobium and molybdenum is dependent exponentially on the applied stress at high temperatures The mean value of the activation energy of the high- temperature ... Dislocations in the Crystal Lattice The concept of dislocations is known to be important in the theory of strength and plasticity [18, 20, 21] Let us recall the main theses of the theory of dislocations ... crystal lattice is not ideal The arrangement of atoms differs from a regular order This is the immediate cause of the great discrepancy between the theoretical strength of materials and the measured...
- 15
- 287
- 0
High Temperature Strain of Metals and Alloys Part 12 docx
... nickel-tungsten alloys, J Jpn Inst Met 1964, 28 (4), 177–200 24 V.K Pishchak, The substructure evolutions and the high- temperature creep mechanisms of metals with face- and body-centered crystal lattices, ... Creep deformation of gamma-primed hardened nickel-based alloys, Jernkontor Ann 1971, (3), 125–133 36 G.A Webster, B.J Piercey, An interpretation of the effects of stress and temperature on the creep ... 40 O.V Rubel, Regulation of selection of a crystallographic orientation of the turbine blades manufactured by the directional solidification method, PhD thesis, Zaporozhye State Technical University,...
- 8
- 521
- 0
Assessing the hazard of metals and inorganic metal substances in aquatic and terrestrial systems
... criteria in the different regulatory arenas in Canada, Europe, and the United States Additional presentations highlighted the state of the science regarding the interpretation of PBT for metals These ... placed at possible risk if the substance enters the environment, with the degree (probability) of risk related to the hazardous nature of the substance and the amount of exposure that occurs Therefore, ... analyses of the degree of partitioning of a variety of metals have been performed to provide insight concerning their persistence in the water column and the rate of delivery of sorbed metal to aquatic...
- 176
- 401
- 0
Báo cáo khoa học: "The combination of deoxynivalenol and zearalenone at permitted feed concentrations causes serious physiological effects in young pigs" ppt
... Primer-R: AGCATCCTGGAGAGATCAGCAT NM213861 IFN-γ Primer-F: AGCTCTGGGAAACTGAATGACTTC MGB Probe: AATTCCGGTAGATAATCT Primer-R: TGATGAGTTCACTGATGGCTTTG X53085 TNF-α Primer-F:GATCATCGTCTCAAACCTCAGATAAG MGB ... Quantification of regulatory and inflammatory cytokine mRNA levels in the spleen of pigs Vertical bars represent the mean ± SE of these results for different treatment (n = 12) It is possible that ... thickening and dilatation in liver, D; Lymphocyte necrosis and deletion of spleen, F; Local necrosis and lymphocyte depletion of lymph node, H; Glomerulus dilatation and the Bowman's capsule full of...
- 6
- 179
- 0
Assessing the Hazard of Metals and Inorganic Metal Substances in Aquatic and Terrestrial Systems - Chapter 1 ppsx
... presentations highlighted the state of the science regarding the interpretation of PBT for metals These presentations provided the © 2007 by the Society of Environmental Toxicology and Chemistry ... placed at possible risk if the substance enters the environment, with the degree (probability) of risk related to the hazardous nature of the substance and the amount of exposure that occurs Therefore, ... During the first day of the workshop, presentations were given on the application of PBT criteria in the different regulatory arenas in Canada, Europe, and the United States Additional presentations...
- 27
- 394
- 0
Assessing the Hazard of Metals and Inorganic Metal Substances in Aquatic and Terrestrial Systems - Chapter 4 pptx
... multiplying the uptake rate constant by the metal water concentration and the elimination rate by multiplying the body metal concentration by the elimination rate constant Under steady-state conditions, ... less than K at the range of metal concentrations investigated, and the above equation reduces to CTB = (max/K) · CW + CBk (4.2) and the ratio max/K is estimated directly The ratio of max/K is ... that essential functions are impaired (e.g., inhibition of enzymes or transporters by binding of metals in the catalytic centre of the molecule) When the rate of metal uptake exceeds the rate of...
- 33
- 376
- 0
Assessing the Hazard of Metals and Inorganic Metal Substances in Aquatic and Terrestrial Systems - Chapter 5 ppsx
... 1999) The ultimate objective is to assess the toxicity of the metal species rather than that of the original metal substance 5.2.1 DATA EVALUATION AND SPECIES SELECTION CRITERIA Toxicity data of the ... species, and (2) the toxicity of these species, rather than (3) the toxicity of the original metal substance There is no doubt that characteristics such as solubility and transformation (and their ... independent of and in advance of the UWM 5.2 DATA ACCEPTABILITY The goal of characterization is often to evaluate and compare the relative hazard/risk of different compounds, whether inorganic...
- 24
- 365
- 0
Assessing the Hazard of Metals and Inorganic Metal Substances in Aquatic and Terrestrial Systems - Chapter 6 (end) docx
... increasing incubation temperature The soil and environmental factors governing attenuation rates were: soil pH, organic matter content, incubation time, and temperature The attenuation of Cu lability ... and invertebrates (the ratio of the concentration in biota to the concentration in soil) can then be compared to the toxicity/soil ratio If the former is much smaller than the latter, the metal ... calculated relative to Cd (Figure 6.5) Further, at least soils should be selected for the tests, one that accentuates the bioavailability of cationic metals (pH to 5.5) and the other that maximizes...
- 27
- 347
- 0
An investigation into the attitudes of teachers and students at the hanoi college of industrial economics towards speaki
... unless they regard the materials they are taught as worth learning Therefore, the task of the teachers is to find out their students‟ goal and the topics 48 they want to learn and build these in the ... description of teaching and learning situation at the HCIE including the English course, the first year students and the teachers at the HCIE It also includes the main part of the study Basing on the ... on one hand and develop their English for Economics on the other hand with the hope that they can use English as a useful tool in their career 30 2.1.3 Description of the teachers at the HCIE...
- 56
- 565
- 1
The interference of mother tongue as vietnames in learning english souds and stress at high school = ảnh hưởng của tiếng mẹ đẻ đối với việc học âm và trọng âm tiếng anh ở trường phổ thông
... words that begin with vowels Read after the teacher Put the book on the top of the shelf He taught us a lot about language Breathe in and breathe out Sit at the back of the room He made a lot of money ... consists of three main parts: Part I is the introduction of the thesis in which we present the reasons for choosing the subject, the aims, the scope, the methods and the design of the thesis Part ... Table of Contents Page Part I: Introduction The Reasons for Choosing the Study The Aims of the Study The Scope of the Study The Methods of the Study 5 The Design...
- 50
- 3,120
- 9
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25