the onrelease event handler for the placeeyes button is completed in this example this button will modify the x and y positions of a movie clip
Báo cáo y học: " Randomised controlled trial of the clinical and cost effectiveness of a specialist team for managing refractory unipolar depressive disorder" ppt
Ngày tải lên :
11/08/2014, 16:22
... been randomised to at the end of 12 months treatment At the end of the study, these guesses will be compared against chance Statistical analysis Statistical analysis for quantitative measures will ... service They will take a stepped care approach as outlined by the NICE guidelines A key feature of the specialist mood disorder team is that a psychiatrist and a cognitive behaviour therapist will ... jointly assess the patient and agree upon a joint formulation of the patient’s problems focusing on maintaining factors for the depression They will then agree upon a joint management plan and...
- 11
- 302
- 0
Báo cáo hóa học: " Research Article On the Monotonicity and Log-Convexity of a Four-Parameter Homogeneous Mean" potx
Ngày tải lên :
22/06/2014, 02:20
... Journal of Inequalities and Applications It contains many mean values, for instance, E 1, 0; x, y I x, y E 2, 1; x, y x y , x / y, ln x − ln y ⎩ x, x y; ⎧ x 1/ x y ⎪ −1 x ⎨e , x / y, yy ⎪ x, x y; ... − yt ln y − yt xt − y t xt ln x xt ln y xt − 3xt xt − y t − xt x2 t 4xt yt y2 t ln x x2t − y2 t yt ln x x2t yt xt yt t 3yt xt − y t 4xt yt y2 t ln y x2 t − y2 t ln y t t 3.5 x2 t 4xt yt y2 t − ln x − ... decreasing (increasing) on 1/2, ∞ Notice for f x, y HL r, s; x, y , exp xfx x, y ln x yfy x, y ln y f x, y exp Gf x, y sxs rxr − s r − s xr − y r x − y s exp1/ r−s I xr , y r I xs , y s xr ln x...
- 12
- 300
- 0
Báo cáo lâm nghiệp:"The relationship between vegetation management and the wood and pulping properties of a Eucalyptus hybrid clone" pdf
Ngày tải lên :
08/08/2014, 01:21
... with a mean annual rainfall and temperature of 1144 mm and 22 °C respectively The trial was located at an elevation of 45 m on an east facing slope Soil parent material is of aeolian origin and is ... extra cost [11], and as such pulp yield is the most important indicator of pulpwood quality Canonical Variate Analysis (CVA), also known as linear discriminant analysis, was used to make comparisons ... Acknowledgements: The Forestry Industry, and in particular the field staff of the Mtunzini Plantation for their assistance in the implementation, maintenance and felling of the trial Dr C Clarke...
- 8
- 387
- 0
Báo cáo y học: "Demonstration of the histopathological and immunohistochemical effects of a novel hemostatic agent, ankaferd blood stopper, on vascular tissue in a rat aortic bleeding mode" pps
Ngày tải lên :
10/08/2014, 09:22
... compliance with the “Principles of Laboratory Animal Care” formulated by the National Society for Medical Reseacrh and “Guide for the Care and the Use of Laboratory Animlas” prepared by the US Natinoal ... particularly in terms of graft patency Intimal hyperplasia can cause aneurysm and thrombus formation [1] In our study, on Days and post-ABS application, histopathological changes in the rat abdominal ... grading system Grade was no apparent reaction product Focal and minimal staining intensity was graded 1, and the most prominent staining reaction Page of covering nearly the whole area of the...
- 7
- 454
- 0
Báo cáo y học: "Quantification of the magnification and distortion effects of a pediatric flexible video-bronchoscope" potx
Ngày tải lên :
12/08/2014, 18:21
... separate experiments and the mean value for all of the diameters of that particular circle at that particular distance was taken as the final magnification for that circle at that distance Page ... is extremely low and in the clinical context these values are highly acceptable as far as measurements are concerned Also it is unlikely that an object will be viewed at this distance for any ... accurate Despite the latter, as there are now many instruments available to the clinician, we suggest that companies and manufacturing regulators make readily available the magnification and distortion...
- 9
- 320
- 0
Assessing the Legal and Regulatory Context of a Corridor
Ngày tải lên :
25/08/2016, 08:07
... logistics, enhanced safety and security, multinational data collection and analysis capability, cooperation in undertaking studies and creating a joint “library” of existing studies, and creation ... rights Ministerial Understanding on ASEAN Cooperation in Transportation This agreement was signed in 1996 by Indonesia, Malaysia, the Philippines, Thailand, and Vietnam Brunei Darussalam and Singapore ... signed by Indonesia, Lao PDR, Malaysia, the Philippines, Thailand, and Vietnam in 1998 Brunei Darussalam, Myanmar, and Singapore have also since joined this agreement, which seeks to facilitate the...
- 20
- 324
- 0
Tài liệu The Economic and Social Effects of Financial Liberalization: A Primer for Developing Countries pptx
Ngày tải lên :
20/01/2014, 19:20
... ty Tỷ lệ vay nợ tăng tạo chắn thuế TN cho doanh nghiệäp (Tax -shield) g ( ) 4/1/2009 Copyright © 2000 Addison Wesley Longman Slide #14-9 Cấu trúc tài ( Lý thuyết trình tư) y y ï) Theo lý thuyết ... EBIT (Earnings before interest and taxes) T : Ta es Taxes EBIT x (1- T)= Lợi nhuận sau thuế nợ vàø vốán cổå phầàn h ka : Chi phí vốn trung bình theo trọng số Nếu EBIT số giá trò công ty phụ vào ... thấp Rủi ro đạo đức (Moral Hazard): X y sau giao dịch Người vay có động cơ/khuynh hướng tham gia vào hoạt động (khơng có đạo đức), mà người cho vay khơ h khơng a thí h g y tì h t thích, ó â tình...
- 31
- 463
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
Ngày tải lên :
06/03/2014, 15:21
... aim of the national report is to review existing information on the use of, and threats to, the Malaysian coastal and marine resources off the Straits of Malacca and the adjacent waters of the Andaman ... Malaysia consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National ... Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The South China Sea The Straits...
- 88
- 581
- 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
Ngày tải lên :
07/03/2014, 15:20
... ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... AAAGGTACCAAAGATGTGGAATCTCCTTCACG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT ... AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGGGCTACTTCACTCAAAG 44/750...
- 9
- 414
- 0
THE NUCLEAR AND AERIAL DYNAMICS OF THE TUNGUSKA EVENT potx
Ngày tải lên :
23/03/2014, 13:20
... volume is that the analysis of the problem is tractable in this domain For example, since the shock front formed in front of this volume is normal, well established relations involving temperature, ... loss by self-fusion and leakage; &, is the deuterium fraction ablating into the stagnation volume and Lf is the normalized leakage factor as discussed and defined in the Appendix AERIAL _2T,Yk4) ... relatively insignificant Also, it is assumed that the Earth is “flat” and that 6’remains constant; that is, the comet trajectory is a straight line Roth of these are excellent approximations for...
- 12
- 444
- 0
Báo cáo khoa học: "A GENERATIVE GRAMMAR APPROACH FOR THE MORPHOLOGIC AND MORPHOSYNTACTIC ANALYSIS OF ITALIAN" ppt
Ngày tải lên :
24/03/2014, 05:21
... attribute is the syntactic category of the lemma: Ior example, the information that to have is an auxiliary transitive verb the fifth is an integer identifying the type of analysis I o b c performed: ... I the analysis can be performed completely the lemma can neither be altered nor affixed (this is the case for example of prepositions and conjunctions) only the longest analysis of the lemma is ... preanalyser and to produce for every form analyzed the list of all its characteristics: I tlere are some example of words analyzed with this grammar: The grammar for the DATE Numbers are...
- 6
- 378
- 0
Báo cáo hóa học: " Feasibility of the adaptive and automatic presentation of tasks (ADAPT) system for rehabilitation of upper extremity function poststroke" pptx
Ngày tải lên :
19/06/2014, 08:20
... motivational feedback Accordingly, in ADAPT, the task difficulty is constantly adapted such that patient always actively performs doable, but challenging, tasks The primary aim of this feasibility ... unrealistic Maintaining challenging performance via adaptive difficulty The adaptive difficulty schedule in the training session aimed to maintain participants’ performance near a challenging ... stroke rehabilitation Acknowledgements This work was supported in part in by the Division of Biokinesiology and Physical Therapy, University of Southern California, and in part by the National Institutes...
- 12
- 612
- 0
báo cáo hóa học:" The OnyCOE-t™ questionnaire: responsiveness and clinical meaningfulness of a patient-reported outcomes questionnaire for toenail onychomycosis" potx
Ngày tải lên :
20/06/2014, 15:20
... of the validation study, performed the statistical analysis, and drafted the manuscript SDM assisted in the design of the validation study, participated in the design of the statistical analysis, ... helped to draft the manuscript FK participated in the design of the statistical analysis and assisted in interpreting results He also designed the statistical plan and analysis of IRON-CLAD® AT designed ... in a clinical measure In this study, target nail clearing and new nail growth provided a clinical basis for estimating the MCID for each scale, as well as for generating an overall MCID for the...
- 8
- 466
- 0
Báo cáo hóa học: "Research Article Convergence Theorems for the Unique Common Fixed Point of a Pair of Asymptotically Nonexpansive Mappings in Generalized Convex Metric Space" pptx
Ngày tải lên :
21/06/2014, 20:20
... 2 Fixed Point Theory and Applications considered the Ishikawa iteration process to approximate the common fixed point of mean nonexpansive mappings in uniformly convex Banach space Takahashi ... Point Theory and Applications Corollary 2.3 Let E be a nonempty closed convex subset of Banach space X, S, T : E → E a pair of asymptotically nonexpansive mappings, that is, Sn x − T n y ≤ a x ... a nonempty closed convex subset of Banach space X, S, T : E → E a pair of asymptotically nonexpansive mappings, that is, Sn x − T n y ≤ a x − y with b / 0, and F defined by b x − Sn x y − T ny...
- 6
- 336
- 0
Dissertation for doctor of philosophy in agriculture study on the growth and development ability of some imported soybean varieties and cultivation techniques for prospect variety in thai nguyen
Ngày tải lên :
14/07/2014, 13:23
... - The survey information was analyzed by the software Excel 5.0 and SAS program - The data from the field experiment was calculated, analyzed by the software Excel 5.0, SAS and IRRISTAT programs ... LAI and the level of Bean pyramid and Lima bean podborer The yield components and yield gradually increased from the treatment (20 kg N/ha) and reached the peak in treatment and then gradually ... rate for soybean was still lower than the guideline Investigating in the status of soybean pests and diseases showed that the pests were mainly Bean pyramid (Lamprosema indicata Fabricius) and...
- 26
- 375
- 0
Báo cáo khoa học: " Immunohistochemistry for detection of avian infectious bronchitis virus strain M41 in the proventriculus and nervous system of experimentally infected chicken embryos" pps
Ngày tải lên :
12/08/2014, 04:21
... detection of several RNA viruses [11] Aim of this study was first to evaluate the suitability of IHC for detection of IBV antigen in paraffinwax embedded CAM and second to analyse the viral antigen distribution ... CAM and embryos using the avidin-biotin complex (ABC) method for immunohistochemistry [39] To this end, sampled CAM and individual whole embryos, containing all organs were fixed for h in Carnoy ... activity in the chicken embryo brain J Biol Chem 1995, 270:19357-19363 Ong E, Nakayama J, Angata K, Reyes L, Katsuyama T, Arai Y, Fukuda M: Developmental regulation of polysialic acid synthesis in...
- 7
- 370
- 0
Báo cáo y học: "Surgical care for the direct and indirect victims of violence in the eastern Democratic Republic of Congo" pps
Ngày tải lên :
13/08/2014, 14:20
... Masisi district hospital was established in the late 1960s as the referral hospital for the district After the August 2007 attacks in Masisi, the hospital was practically abandoned as staff and patients ... respiratory infections, tuberculosis, and neonatal deaths [7] The terrain is mountainous and poor roads mean the area is only accessible by all terrain vehicles and motorbikes for most of the year On August ... without intubation) which are safer types of anesthesia to administer for nurse-anesthetists or anesthesia providers that are informally trained The potential for non-surgeons to manage a substantial...
- 6
- 451
- 0
Báo cáo y học: "Biochip sensors for the rapid and sensitive detection of viral disease" pps
Ngày tải lên :
14/08/2014, 14:21
... addressed the problem Infected cell (a) (b) RNA PROTEIN Sample preparation and hybridization Sample preparation and hybridization DNA array Scanning of array Protein array Image analysis Figure The ... studies as well as standardization of data measurements and quality assurance Increasing attention is being given to these critical areas, and as a consequence we are in exciting times in this rapidly ... the array They also highlighted the advantage of the array’s internal calibration curve: by processing the calibration Elevation of intracellular calcium refereed research Microarray applications...
- 5
- 285
- 1