... related to the participant's oral impact In other words, occlusal traits that affect dental appearance and have an impact on participants' daily lives may not be captured by IOTN In addition, DAI ... and palate as well as any craniofacial anomaly, Class II and Class III buccal occlusions, and hypodontia Only the highest scoring trait is used to assess treatment need [29] Thereafter, adolescents ... study and critically revised the manuscript All authors read and approved the final version of the manuscript Acknowledgements Eduardo Bernabé was supported by the Programme Alßan, the European...
Ngày tải lên: 18/06/2014, 19:20
... 0021-9045(88)90006-8 Shah, WM: A generalization of a theorem of Paul Turan J Ramanujan Math Soc 1, 67–72 (1996) Aziz, A, Rather, NA: A refinement of a theorem of Paul Turan concerning polynomials Math Ineq Appl ... Inequalities and Applications 2011, 2011:111 http://www.journalofinequalitiesandapplications.com/content/2011/1/111 Page of The above lemma is due to Chan and Malik [11] Lemma 2.4 If p(z) is a polynomial ... Cite this article as: Zireh: On the maximum modulus of a polynomial and its polar derivative Journal of Inequalities and Applications 2011 2011:111 Submit your manuscript to a journal and benefit...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo toán học: "Maximum Multiplicity of a Root of the Matching Polynomial of a Tree and Minimum Path Cover" pdf
... known that the matching polynomial of a graph G is equal to the characteristic polynomial of G if and only if G is a forest To prove Theorem 3.3, the following characterization of θ-essential vertices ... Consequently, Theorem 1.2 If G has a Hamiltonian path, then all roots of its matching polynomial are simple The above is the source of motivation for our work It is natural to ask when does equality ... 3.2]): Theorem 3.1 (Gallai-Edmonds Structure Theorem) Let G be any graph and let D0 (G), A0 (G) and C0 (G) be the 0-partition classes of G (i) (The Stability Lemma) Let u ∈ A0 (G) be a 0-special...
Ngày tải lên: 07/08/2014, 21:21
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... such that either the HA or the HIS epitope tag was added to the end of the ESSS ORF The forward primer was: 5¢-ACga atccGATCTCCGACCCA-3¢; the reverse primer was: 5¢-ATgctagcCTCATCTTCTGGTAACTGG-3¢ ... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... fraction is designated as the mitochondrial fraction Immunochemical assays and antibodies Mitochondrial protein samples (between 50 and 100 lg) were separated by SDS/PAGE and BN/PAGE and transferred...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf
... 2006) They used a natural language tagger which was trained on the output of ParaMor and Morfessor The goal was to mimic each algorithm since ParaMor is rule-based and there is no access to Morfessor’s ... the mathematical model and performed experiments on language data of the morphologically complex language Zulu We compared the performance on increasing training set sizes and analysed for each ... terms of training set size We want to remind the reader that our two algorithms are aimed at small datasets We randomly split each dataset into 10 subsets where each subset was a test set and the...
Ngày tải lên: 20/02/2014, 04:20
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... carried out using the CARA and ENCAD algorithms included in the GENEMINE program Bacterial strains and vectors The mutagenesis and expression phagemid, pGHX(–) was produced in our laboratory and...
Ngày tải lên: 21/02/2014, 01:21
SAVINGS BANKS AND THE DOUBLE BOTTOM-LINE: A profitable and accessible model of finance doc
... List of Tables Table Table Table Table Table Loan size and average savings balances for commercial banks Loan size and average savings balances for savings banks Savings banks’ lending volumes and ... Finally, there are the large state banks with a specific savings mandate that are common throughout East Asia and some parts of Latin America Clearly the regional characterisations of these different ... there has always been a clear dual mandate to (a) reach a target group not well served by commercial banks but (b) try and make a reasonable profit so that the outreach achieved can be sustained...
Ngày tải lên: 06/03/2014, 10:20
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... Asp140, Asp142, Glu144 and Asp215 were mutated individually to asparagine and alanine, Tyr10 and Tyr214 were replaced by Phe, and Ser93 was replaced by alanine All clones expressing ChiB variants ... in the pH 4.2– 8.0 range, and a marked increase in Km at alkaline pH (Table 2, Fig 3) The D215N and D140N mutants displayed an acidic shift in the pH-activity profiles, whereas the Y214F and the ... pKa calculations pKa values for Asp140, Asp142, Glu144 and Asp215 were calculated in several ChiB mutants as described in Materials and methods (Table 3) Calculations were primarily based on the...
Ngày tải lên: 07/03/2014, 14:20
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The ... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate,...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of ... permeation/proteome proteome of the target microorganism and no microbial resistance; and (b) the design of potential coadjuvants of those antimicrobial agents that are already available after ... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm ... of the eyestalk (open bar) and thoracic ganglia (diagonally shaded bars) of females The percentage indicates the GSI of the females M (B) indicates the expression pattern of MIH-B in the same ... culture tanks At 24, 48 and 72 h after injection, the hepatopancreas and ovary of the shrimp were dissected for total RNA preparation, and the hemolymph samples were collected for SDS ⁄ PAGE and western...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and 5¢-ggacccgttttgcgTTTtcgaaagtgagc-3¢ Preparation of Ec DosH The (His)6-tagged Ec DosH proteins (wild-type and ... states of Leu mutants of Ec DOS N Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and ... whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... dividing the optical density of each band stained with antibodies to Glu- and nitrotyrosinated tubulin by that of an identical sample stained with DM 1A antibody Capabilities of nitrotyrosinated and ... nitrotyrosination of a- tubulin and cellular dysfunction 10 11 12 13 14 15 ACKNOWLEDGEMENTS 16 We thank Drs Carlos E Argarana and Mario Guido for critical ˜ reading of the manuscript, Mrs S N Deza and Mrs ... of optical density values for pellet and supernatant, multiplied by 100 The same formula was used to calculate percentage of assembly from radioactivity values Cell viability and proliferation...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt
... nonradioactive ATP were added After the addition of Q-0 and/ or ATP samples were taken immediately and after 0.5, 1, 2, 4, 8, 16 and 32 min; the reaction was stopped by the addition of sample buffer The half-life ... of a cell, and it was recently shown that they can bind small ligands such as FAD and ATP [13,29,31] In fact, mutations in this domain have been reported which cause either the inactivation of ... note that the PAS domain of the phosphorelay histidine kinase A of Bacillus subtilis was recently shown to be a catalytic ATP-binding domain [31] As the PAS domain of BvgS contains a putative ATP...
Ngày tải lên: 17/03/2014, 23:20
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx
... were also common The main laboratory data gathered at the time of NAFLD diagnosis are summarised in table ALT and AST levels were each within the normal range in few patients 1539 Hepatology Table ... specific age and sex in each individual case {Includes the normal laboratory values for boys and girls for the age range of our patient population {Based on percentile for age and sex ALT, alanine aminotransferase; ... (serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase (GGT), total bilirubin, albumin levels and prothrombin time), fasting...
Ngày tải lên: 22/03/2014, 10:20
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx
... States, the internationalization of accounting standards may lead to a change in the language of accounting • The growth of outsourcing and an upsurge in the offshoring of services and manufacturing ... CAE of a global defense and aerospace company that buys parts from around the world said that vendor quality and standards are of primary concern to all global companies She said that when she assesses ... impacting internal audit today and in the future As organizations expand to take advantage of global markets and supply chains, internal audit faces a burgeoning need for its services A majority...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf
... Matera et al [26]; the optical spectrum of the ferric form exhibited a rather broad Soret band, whereas the Soret bands of the ferrous and ferrous-CO forms were narrow (Fig 1B) The ratios of the ... dithionite was added gradually to the verdohaem complex under anaerobic conditions, decreases in absorbance at 400, 535 and 690 nm took place and broad bands appeared at 431 and 795 nm (Fig 4A, spectrum ... absorption maxima at 409 and 638 nm that are characteristic of the CO-ferrous verdohaem complex [31,37] Further exposure to air caused a loss of the absorption maxima at 340, 409 and 638 nm, and subsequent...
Ngày tải lên: 23/03/2014, 21:20
THE KYBALION A Study of The Hermetic Philosophy of Ancient Egypt and Greece potx
... to aid in the thought and study of the various degrees and Forms of universal activity and life The atom of matter, the unit of force, the mind of man, and the being of the arch -angel are all ... of the Seven Minor Planes of the Great Physical Plane These Seven Minor Physical Planes are as follows: The Plane of Matter (A) The Plane of Matter (B) The Plane of Matter (C) The Plane of Ethereal ... nevertheless, exist and play their part of the Drama of the Universe Their degree of intelligence is between that of the mineral and chemical entities on the one hand, and of the entities of the...
Ngày tải lên: 29/03/2014, 02:21
Natural History of Tuberculosis: Duration and Fatality of Untreated Pulmonary Tuberculosis in HIV Negative Patients: A Systematic Review pdf
... overall mortality ratios (i.e the ratio of mortality to notification as reported by the departments of Health of the various cities and states in the USA, and the Ministry of Health in the case of ... description of the available data was sufficient to enable calculation 5- and/ or 10-year survival probabilities or disease duration, and e) the study population was not treated with chemotherapy or was ... of the mortality rate and the CF estimates the incidence rate, and one can use the fact that the prevalence equals the product of the incidence and the duration (P = I*D) to obtain the duration...
Ngày tải lên: 29/03/2014, 03:20
Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx
... both the initial fricative and the final plosive at Stage Again, it may be possible to identify a unique word candidate at the end of Stage 2, but if several candidates are available, recognition ... (non-spontaneous voicing) and N (nasality), and the resonance elements A (low), I (palatal), U (labial) and R (coronal) These elements are phonologically active - they can spread to neighbouring segments, ... segment-based cues contrast steadystate formant values at the centre of a segment with values at entrance and exit boundary They describe the context of a segment without going to the computational...
Ngày tải lên: 31/03/2014, 04:20