... so complex a system as a developing embryo, then facts - and indeed understanding - at many levels must be fed into the mathematics Nor should the value of facts and understanding on their own ... safe to generalize), in which fibroblast growth factor (FGF) and Wnt signaling are also implicated, and in which the Hes/her cellintrinsic oscillator may not be the only one Robertson least in ... biological facts, which are almost always beyond the reach of most people's intuition, seem to indicate that an even more complex system operates in mammals (or at least mice, from which it is probably...
Ngày tải lên: 06/08/2014, 19:20
... in the North Cachar Hills, Chirang and New Bongaigaon districts in Assam; in Ashapara and Naisingpur camps at Kanchanpur in North Tripura district; in Kandahmal, Orissa; and in the Kashmir Valley ... Data and Notes for Statistical Profiles of States 43 Andhra Pradesh 45 Assam 48 Bihar 51 Chhattisgarh 54 Delhi 57 Gujarat 60 Haryana 63 Jharkhand 66 Karnataka 69 Kerala 72 Madhya Pradesh 75 Maharashtra ... Andhra Pradesh and Karnataka.102 The rural-urban differential in early marriage is very significant While 48 per cent of women aged 20-24 years in rural areas married before attaining the legal age,...
Ngày tải lên: 30/03/2014, 03:20
báo cáo sinh học:" The role of pharmacists in developing countries: the current scenario in Pakistan" potx
... Pakistan's population Pakistan extends from the mountain valleys of the Himalayas to along the Arabian Sea bordering India, China, Afghanistan and Iran It is strategically located along the ancient ... was established at the University of Karachi The pharmacy programme was initiated as a three-year baccalaureate programme, and then in 1978–1979, it was lengthened to a four-year programme At ... recognition of pharmacists as health care professionals The lack of trained personnel and the resulting lack of contact of pharmacists with the public are In 2003, the Doctor of Pharmacy (Pharm.D) began...
Ngày tải lên: 18/06/2014, 17:20
STOICHIOMETRY AND RESEARCH – THE IMPORTANCE OF QUANTITY IN BIOMEDICINE potx
... conformation, with the two carboxylato-bearing rings pointing inward the calixarene cavity to maximize electrostatic and van der Waals interactions with the cationic paraquat These adaptive conformational ... to binding Structural analyses of the remaining water at the interface in protein-DNA complexes indicate that a majority of these water molecules promote binding by screening protein and DNA electrostatic ... method was applied to quantify the spectral changes using various molar amine/calixarene ligand ratios by maintaining a constant ligand concentration (λmax = 520–534 nm) and varying the amine concentration...
Ngày tải lên: 28/06/2014, 17:20
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ... ACGTTGGATGAAAATACTGGGACTCGAGGC rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGAATCCCCGCAGACCATGACAC fwd ACGTTGGATGAGTCGGTAGCAACACCAGG ... ACGTTGGATGTTGCTCAGCCCCAAAGATGG fwd ACGTTGGATGAGAAACAGGAAGGAAGGTCC rev ACGTTGGATGTATGGTTCGACTGAGTCCAC ACTCGAGGCCTGTGAATTCC 93.73 GCCGGCTCCCAAGCTCC 92.03 CCTGCTGGCCATGCTCCTCAGC 92.99 GCTGCCTCTGCTCCCAGG...
Ngày tải lên: 12/08/2014, 16:20
BÀI LUẬN TIẾNG ANH HAY the importance of computers in the modern world
Ngày tải lên: 17/08/2015, 11:16
Analysis on the growth of bribery in china a preliminary study
... to all the administrative staffs in the i General Office of the Department of Political Science—Stephanie, Noor Sham bte Abdulhamid, Lillian Low, Vijayalakshmi Rehunathan, Mumtaj d/o Haniffa and ... most important anti-bribery policy in China By comparing the articles in the criminal law about embezzlement and bribery and private theft and swindling, Manion argues that the criminal law is more ... same chapter In the fourth chapter, I will examine the trend of bribery in China in the period of 1998-2007, mainly at the national level After 10 answering the question of whether bribery in...
Ngày tải lên: 29/09/2015, 13:01
Báo cáo y học: "An unusual case of gout in the wrist: the importance of monitoring medication dosage and interaction. A case report"
... familiar with these changes, especially in the early stages of bone and joint destruction Radiographs still remain the imaging examination of choice for gouty arthritis although advanced imaging ... techniques may be used The appearance of gout in MR imaging is variable Joint effusion and para-articular edema may be present in an inflamed joint Tophaceous deposits will appear low to intermediate ... well as medication interactions Case presentation A 77 year old male was treated at a chiropractic clinic for low back pain resulting from lumbar facet arthrosis and lateral canal stenosis On a...
Ngày tải lên: 25/10/2012, 10:06
DEVELOPING A COMPETITIVE STRATEGY: A CASE STUDY OF THE THANGLONG GARMENT COMPANY IN HANOI, VIETNAM
... examining the costing plan for a two-layer jacket (Appendix 5, Table 2) After calculating manufacturing cost, 10% of profit rate is added then 10% of VAT (value-added tax) and another 10% retail ... VINATEX manages forty-seven member enterprises engaging in yarn spinning, fabrics, weaving and garment making; one financial company; three mechanical repair and xxiv spare parts manufacturing ... The information in Table 19 does not indicate market share of each company in the table, but we can understand that Thaloga might have a large market share of jacket in domestic market, company...
Ngày tải lên: 23/04/2013, 10:29
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh
... latrines and hand pumps which were installed at the beginning of the establishment of Bauniabad area The main activities included; (i) a baseline and needs assessment survey, (ii) training of ... is one of the international NGOs They helped the local people to install the biogas options by sharing a part of the installation cost Biogas plant sewerage system in Bauniabad Based on the results ... operate and maintain the biogas plant system continuously, it is necessary to establish the operation and maintenance system including the maintenance cost sharing by the local people At this stage,...
Ngày tải lên: 05/09/2013, 09:08
báo cáo hóa học:" The importance of early arthroscopy in athletes with painful cartilage lesions of the ankle: a prospective study of 61 consecutive cases" ppt
... joint line and a mark was made where the oedema disappeared The mark was made parallel to the joint line and the reading was taken perpendicular to the two lines The perpendicular line was measured ... exertion pain as the predominant symptom The remaining 10 (46%) complained of a mix of occasional pain, swelling and stiffness, occasional instability and occasional clicking and locking 15/17 of the ... speculate that the inaccuracies of the scans are due to the fact that the majority of sequences can not define the cartilage from the subchondral bone The cartilage is either the same intensity as...
Ngày tải lên: 20/06/2014, 00:20
báo cáo khoa học: "The importance of organizational characteristics for improving outcomes in patients with chronic disease: a systematic review of congestive heart failure" pdf
... [21-25] The insight that clinical settings are CASs is important to the field of implementation research, as it provides guidance for how to approach disseminating research findings into routine care ... being cared for Diseases may mediate the way that interventions influence a patient’s care The level of complexity of different diseases, and the ways that chronic diseases Page of 10 impact patients’ ... jointly abstracted in Page of 10 detail by teams of two investigators Disagreements were resolved by consensus of the group of investigators Assessment of leveraging of characteristics of CAS...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: "Clinical importance and impact on the households of oseltamivir-resistant seasonal A/H1N1 influenza virus in healthy children in Italy" ppt
... (0.05 μM); A/ H3-forward CCTTTTTG TTGAACGCA-GCAA (1 μM); A/ H3-reverse CGGATGAGGCAACTAGTGACCTA (1 μM); A/ H3-probe VICCCTACAGC-AACTGTTACCMG BNFQ (0.25 μM); B-forward TCACGAAAAATACGGT GGATTAAA (0.75 ... BIOTIN-CCACGTTTTGATTAAAAGACACC; N1 275-sequence AGTTGAATGCACCCAAT; N1 294sequence TGTGTGTATGCAGGGAC; N2 119-forward TTTTATCTGACCAACACCACCATAGAG; N2 119reverse BIOTIN-CGCTAAGGGGTCCTATCATGTACT; N2 119-sequence ACATCTGGGTGACAAGA; ... Italian Ministry of Health (Bando Giovani Ricercatori 2007) We would like to thank Laura Cesati, Laura Gualtieri and Emanuela Laicini (Milan, Italy); Andrea Papaleo and Luigi Cantarutti (Padua, Italy);...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "A rare cause of specific cough in a child: the importance of following-up children with chronic cough" ppt
... carcinoma that arose from the right upper lobe bronchus was so large it protruded into and obstructed the entire right main stem and is clearly visible at the carina (large arrow) The left main ... indicator that further follow-up and investigations are usually required This child had clinical features of bronchiectasis for at least several months and most likely a few years Page of (page ... subset of this population and are particularly afflicted by respiratory illness [15,16] As many of the presenting respiratory symptoms have an infective cause, the diagnostic suspicion of carcinoma...
Ngày tải lên: 13/08/2014, 08:20
Đề tài:what qualities and skill are needs for the manage people in a company? what is the importance of good human resources?
... learn and develop further 5)wise in the handling of document • A good manager must know how in the processing data Maybe managers are afraid of cumbersome paperwork but the manager also very intoxicated ... create an environment where new ideas can flow and flourish, follow some of these basic leadership and management practices 7)Information processing and thinking capacity • The power of your brain ... improve themselves and makes an effort to meet the employees’ expectation A good manager always put the interests of employees first.And the role of managers is to find the balance between business...
Ngày tải lên: 26/12/2014, 08:36
LUẬN MẪU LỚP 12 The importance of good roads in a country
... Life in the village The village has always been known to be a place of peace and quiet The scattered houses among hundreds of plants and trees at once indicate the lack of activity in the village ... contented In the afternoon, most of the villagers are at home Some of them take a nap after lunch; some work in their small gardens, and some visit the small shops in the village In various parts of the ... village children may be seen playing the popular games of the village Occasionally, a cyclist passes by Then, in the evening, the villagers meet one another Some play cards and other types of games...
Ngày tải lên: 15/07/2015, 23:18
A STUDY ON THE IMPORTANCE OF LEARNER IDEAL SELF TO THE SUCCESS IN LEARNING ENGLISH OF THE LEARNERS AT THE BORDER GUARD ACADEMY
... immediately came up with the idea of doing a study of the importance of the Learner Ideal Self to the Success in Learning English of the Learners at The Border Guard Academy It is unarguable that ... out the answer Aim of the study The research is done for the purpose of finding out the role of the learner ideal self in the success in learning English of the learners at the Border Guard Academy ... objectives of the study are as follows: - To examine the kinds of motivation that affect the learners’ success in English learning of the learners at the Border Guard Academy - To examine the extent of...
Ngày tải lên: 14/09/2015, 09:29
Basic understanding about cancer and the importance of a national surveillance and research program in Vietnam
... in the growth, spread and death avoiding machinery of cancer (12) The main advantage of targeted therapy is that they focus to the specific cellular and molecular changes of cancer cells; therefore, ... Cancer and cancer surveillance in Vietnam Figure 1: Solid and liquid tumors A Carcinoma of the urinary system Cancer can occur anywhere along the urothelium, an epithelial layer lining the urinary ... infectious diseases, as well as advances in cancer diagnosis and social awareness of the disease Males Prostate Lung and Bronchus Urinary Bladder Colorectal Melanoma of the Skin During the three time...
Ngày tải lên: 20/06/2016, 23:20
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... Determining the concept of the research • Collecting the necessary data for the research • Analyzing and interpreting the research data • Stating the findings and recommendations The first two phases ... factors as ways to achieve brand awareness: • Involve a slogan or jingle: a slogan is a visible feature of a brand There can be a strong link between a slogan and a brand The slogan and jingle are ... measurement of brand equity because of the necessity in today’s marketplace to develop, maintain and use product branding to acquire a certain level of competitive advantage According to Ailawadi...
Ngày tải lên: 24/09/2012, 17:19