the hematopoietic stem cell niche at a glance

The Respiratory System at a Glance doc

The Respiratory System at a Glance doc

... bronchiectasis - lung abscess - empyema Interstitial fibrosis Uncommon Bacterial endocarditis Cyanotic heart disease Inflammatory bowel disease Malabsorption Atrial myxoma Cirrhosis Familial Idiopathic Pleural ... this region Low Increased Low Unchanged Normal Unchanged (b) Variation of ventilation, V A , perfusion, Q and ventilation–perfusion ratio, V A /Q with vertical height in the upright lung V A Q R = The respiratory gas exchange ratio ... lower Posterior aspect (c) Bohr equation for measuring dead space Anatomical dead space, Volume = V D Respiratory zone: Alveolar CO 2 fraction = F A CO 2 End of inspiration End of expiration End-tidal = alveolar...

Ngày tải lên: 05/03/2014, 11:21

127 1,9K 0
The Sector’s “Positives” at a glance 1992-2012 doc

The Sector’s “Positives” at a glance 1992-2012 doc

... Farmer Burj Attari AI Technicians Training Farm Multan AI Technician Training Farm Peer Mahal Zone Project Coverage Map Khanewal (Farmer trainings) Kamalia (Farmer training) Milk collection infrastructure ... in collaboration with Punjab Vocational Training Council (PVTC)  Training course duration 30 days  Practical training covered at Large Animal Slaughter House, Lahore.  Training to other Agencies ... set-up at a local farm at GOJRA Thank you Dairy Project – DRDF-USAID • A. I training in :Burj Attari (Lahore) and South Punjab (Multan). • Farmers and LLW’s :Training in NPL Sukheki, NPL Sarsabz,...

Ngày tải lên: 24/03/2014, 04:20

27 371 0
Tài liệu contents at a glance - routing 1 pdf

Tài liệu contents at a glance - routing 1 pdf

... this watermark. Please purchase PDF Split-Merge on www.verypdf.com to remove this watermark. Please purchase PDF Split-Merge on www.verypdf.com to remove this watermark. Please purchase PDF ... this watermark. Please purchase PDF Split-Merge on www.verypdf.com to remove this watermark. Please purchase PDF Split-Merge on www.verypdf.com to remove this watermark. Please purchase PDF ... Please purchase PDF Split-Merge on www.verypdf.com to remove this watermark. Please purchase PDF Split-Merge on www.verypdf.com to remove this watermark. Please purchase PDF Split-Merge...

Ngày tải lên: 10/12/2013, 17:15

11 456 0
Tài liệu TOEFL ibt at a Glance ppt

Tài liệu TOEFL ibt at a Glance ppt

... measure the ability to combine informa tion from more than one source and communicate about it. Is a sample test av ailable? Y es, a complete test can ... Listening and Reading questions are a vailable for US$40. Those wishing to receive a practice Speaking score can take the TOEFL Academic Speaking T est (TAST) ... www .ets.org/toefl. What will the fee for the new test be? The fee in 2005 will be US$140. Communicate with Confidence For the latest information about the next gener ation ...

Ngày tải lên: 11/12/2013, 19:15

3 365 0
Tài liệu THEORY AT A GLANCE: A GUIDE FOR HEALTH PROMOTION PRACTICE ppt

Tài liệu THEORY AT A GLANCE: A GUIDE FOR HEALTH PROMOTION PRACTICE ppt

... social marking at the community level, media advocacy at the policy level, and mass media campaigns at the population level. 29 Public health communications can increase knowledge and awareness ... Evaluation Planning Explanatory Theory Why? What can be changed? THEORY AT A GLANCE Because the social context in which behavior occurs is always evolving, theories that were important ... by creating user-friendly materials for teachers and cafeteria workers. By making the materials available on a Web site, they can enhance its trialability. Professional demonstrations of the...

Ngày tải lên: 14/02/2014, 22:20

64 2,6K 1
Medical Statistics at a Glance pot

Medical Statistics at a Glance pot

... categorical data Geometric Before back- mean transformation, it has the same advantages as the mean Appropriate for right skewed data Weighted Same advantages as mean the mean Ascribes relative ... mean are identi- cal if each weight is equal to one. Table 5.1 Advantages and disadvantages of averages. Type of average Advantages Disadvantages Mean Uses all the data values Algebraically ... is the value that occurs most frequently in a data set; if the data are continuous, we usually group the data and calculate the modal group. Some data sets do not have a mode because each value...

Ngày tải lên: 15/03/2014, 12:20

139 417 0
Medical Pharmacology at a Glance doc

Medical Pharmacology at a Glance doc

... the following effec ts ;ITC excita tory and whi ch arc inhibitory. I Pupillary dilat ation (more light reaches the retina). 2: Bronchiolar dilatation rfacituatcs increased ventilation). 3 Hea rt rate and force <Ire incre ... thc admi nistration of an inhalation anaesthetic. 1I 11 lulhant' was the hrvtIluorinutcd volatile anaesthetic and was widely' used in thc UK. However. il is associated wilh a very low ... heart heat and maintains the blood pressure hy lucrcaving the vusculur resis tance. In the failing heart. the resulnng increase in the resistance agai nsl which the heart has 10 pump (afterlnadl...

Ngày tải lên: 15/03/2014, 14:20

100 1,2K 0
MARKETING EDUCATION (0561) - TEST AT A GLANCE doc

MARKETING EDUCATION (0561) - TEST AT A GLANCE doc

... including human resource management, information management, interpersonal communication, operations and strategic management III. Marketing-Information Management and Planning ã market research, including ... principles, the analysis of complex situations, and the ability to synthesize information that is considered essential for a marketing education teacher. The examination is typically taken by examinees ... when the (A) quantity demanded changes a great deal as prices fluctuate (B) quantity demanded barely changes with a change in price (C) change in quantity demanded is in the same proportion as the...

Ngày tải lên: 15/03/2014, 22:20

7 453 0
Health At A Glance - Europe 2010 pdf

Health At A Glance - Europe 2010 pdf

... (Bulgaria, Cyprus, Latvia, Lithuania, Malta and Romania), readers should consult the Eurostat Database at http://epp.eurostat.ec.europa.eu/ portal/page/portal/statistics/search_database. Readers ... source is the Eurostat Statistics Database. The international comparability of cancer mortality data can be affected by differences in medical training and practices as well as in death certification ... Ischemic heart disease, mortality rates, 2008 (or nearest year available) Source: Eurostat Statistics Database. Data are age-standardised to the WHO European standard population. 1 2 http://dx.doi.org/10.1787/888932335552 1.4.2....

Ngày tải lên: 22/03/2014, 16:21

130 4K 0
japanese verbs at a glance

japanese verbs at a glance

...

Ngày tải lên: 27/03/2014, 12:20

91 349 1
RepRoductive HealtH at a GLance pot

RepRoductive HealtH at a GLance pot

... population. 1 e high maternal mortality ratio at 530 maternal deaths per 100,000 live births indicates that access to and quality of emer- gency obstetric and neonatal care (EmONC) remains a challenge. 4 HIV ... Implementation Plan for the years 1999–2003 1999: National Plan Of Action For The Elimination of Female Genital Mutilation in Kenya, 1999–2019. 2000: The National Population Policy for Sustainable ... generated. ã Strengthen post-abortion care (treatment of abortion compli- cations with manual vacuum aspiration, post-abortion family planning counseling, and appropriate referral where necessary)...

Ngày tải lên: 28/03/2014, 16:20

5 385 0
haematology at a glance

haematology at a glance

...

Ngày tải lên: 11/04/2014, 09:44

121 351 0
hematopoietic stem cell protocols

hematopoietic stem cell protocols

... LacZ PCR primers: lacz1 5’GCGACTTCCAGTTCAACATC3' lacz2 5’GATGAGTTTGGACAAACCAC3' 8. YMT2 PCR primers: ymt1 5’CTGGAGCTCTACAGTGATGA3' ymt2 5’CAGTTACCAATCAACACATCAC3' 9. Myogenin ... a Ficoll separation will not en- rich the stem cells relative to the other nucleated cells. Whole bone marrow: Whole aspirated bone marrow is essentially always con- taminated with variable amounts ... embryo before the appearance of cells with adult repopulating capacity. Thus, the accepted view of the adult hematopoietic hier- archy with the hematopoietic stem cell (HSC) at its foundation does...

Ngày tải lên: 11/04/2014, 09:45

318 390 0
w