the fukushima disaster a cold analysis

... P5 M 35 FG Ahmadiyya Pakistani Hindi P6 M 37 FG Ahmadiyya Pakistani Hindi P7 M 33 FG Ahmadiyya Pakistani Hindi P8 P9 M M 24 47 Interview Interview Ahmadiyya Pakistani Ahmadiyya Pakistani Hindi ... type Background P1 M 39 Interview Ahmadiyya Pakistani Interview language Hindi P2 M 23 Interview/FG Ahmadiyya Pakistani Nepali P3 M 30 FG Ahmadiyya Pakistani Hindi P4 M 34 FG Ahmadiyya Pakistani ... Interview/FG Ahmadiyya Pakistani Hindi P11 M 24 Interview Ahmadiyya Pakistani Hindi P12 M 35 Interview Ahmadiyya Pakistani Hindi P13 F 31 Interview Ahmadiyya Pakistani Hindi P14 F 36 Interview Ahmadiyya...

Ngày tải lên: 13/08/2014, 15:21

... New Zealand, Nicaragua, Niger, Nigeria, Norway, Pakistan, Panama, Papua New Guinea, Paraguay, Peru, Philippines, Portugal, Rwanda, Senegal, Sierra Leone, South Africa, Spain, Sri Lanka, Sudan, ... 1.00 Hakan Yilmazkuday Note: The list of 84 countries is as follows: Algeria, Argentina, Australia, Austria, Bangladesh, Barbados, Belgium, Bolivia, Brazil, Cameroon, Canada, Central African Republic, ... India, Indonesia, Iran, Islamic Rep., Ireland, Israel, Italy, Jamaica, Japan, Jordan, Kenya, Korea, Rep., Lesotho, Luxembourg, Malawi, Malaysia, Malta, Mauritius, Mexico, Morocco, Nepal, Netherlands,...

Ngày tải lên: 21/04/2016, 07:47

... the DNA damage recognition process Both RPA and XPA preferentially bind damaged DNA, and because RPA and XPA directly interact in the absence of DNA, the RPA-XPA complex has been implicated as ... Whitehead A, Whitehead J A general parametric approach to the meta -analysis of randomized clinical trials Stat Med 1991; 10: 1665-7 32 Begg CB, Mazumdar M Operating characteristics of a rank correlation ... to DNA and form DNA adducts that are capable of inducing mutations and initiating carcinogenesis The capacity to repair DNA damage induced by activated carcinogens 61 appears to be one of the...

Ngày tải lên: 31/10/2012, 14:59

... degradation All these factors may affect the yield gap but their consideration was beyond the scope of our study as consistent spatially explicit data are not available at the global scale The ... appropriate data Globally consistent and comparable fertilizer application data are only available at the national scale We obtained grain type specific fertilizer application rates per country from the ... Tanzania, Zambia, Malawi, Angola, Namibia, Botswana, and Swaziland c Includes Vietnam, Philippines, Cambodia, Burma, Laos, and Malaysia a yield variation This example underpins the necessity to...

Ngày tải lên: 16/12/2012, 15:22

... • What are the grammatical and semantic features of each verb and how are they similar and different in terms of these features? • What are their synonyms and idioms? • What are the implications ... between the studied objects in terms of MiCA and MaCA basing on the theoretical background As far as MiCA was concerned, these two verbs are analyzed and contrasted in respects of grammatical features, ... language the author has attempted to figure out the overall grammatical features as well as semantic features of the verb ‘run’ Perhaps, it’s unfeasible to draw a perfect picture about the meanings...

Ngày tải lên: 06/04/2013, 08:43

... near the cathode side area The maximum stress appears in the cathode side surface of the membrane, implying that major heat generation takes place near this region It can be seen also that the ... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... mechanical, thermal, and electrical contact between the central parts of the gas diffusion backing and Membrane-Electrode-Assembly (MEA) 2.2 Model equations 2.2.1 Air and fuel gas flow In natural...

Ngày tải lên: 05/09/2013, 14:58

... Collecting data - Analyzing data - Discussing the findings: synthesize the findings and draw conclusion - Putting forwards some implications 3.5 DATA ANALYSIS On the basis of 100 EOASs, the data will ... him/herself has made a great contribution to art /science/politics/etc.[62] 2.2.8.3.Some Notes on the Oscar Wikipedia cites “An Academy Award, also known as the Oscar, is granted by the American Academy ... Martha, my daughters Veronica, Raffaella, Francesca, Carolyna, little Dina for the moment [85] In the first instance, the italic word is an example of personal reference The item They in the...

Ngày tải lên: 26/11/2013, 13:28

... Color black coffee black eyelash as black as coal 51 (17%) Complexion black black face as black as 37 soot (12,33%) Animals black bird Black as black as 27 swallowtail crow (9%) as black as the 25 ... a statistical package for the same tasks 11 12 CHAPTER METHODOLOGY AND PROCEDURES - Examining the pragmatic features of the adjectives Black and Đen - Giving contrastive analysis of Black and ... essential to give out the methods and procedures of the study In addition, the source of data as well as data analysis are also mentioned And in Chapter Four the findings of the research on the semantic...

Ngày tải lên: 26/11/2013, 13:29

... because an educational message may be addressed to a receiver and it is associated almost with the addresser, and generally entails an attenuation of the emotive function Moreover, a correlation ... and explorative approaches A contrastive analysis was conducted with English as L2 and Vietnamese as L1 3.2 DATA COLLECTION 3.2.1 Sampling After observing many ads, we picked out about 200 particular ... business? The long Island Association The long Island Association Advocacy Networking Benefits LIA Long Island Association Leading long island Learn more In (52) “LIA” was illustrated by The long Island...

Ngày tải lên: 26/11/2013, 13:29

... important and significant characteristics of the WDBs As a result, the topic A Contrastive animals that nature has provided to feed both our body and spirit As Analysis of the Semantic and Pragmatic ... by the WDBs that once the WDBs are used, the speaker and the hearer must have This thesis has made a study of the semantic and pragmatic the same image or meaning of these words If we both have ... translational versions as well as make progress in cultures concerning the matter under discussion In other words, their translation contrastive and comparative analysis of the language matter can...

Ngày tải lên: 26/11/2013, 13:30

... War II was in the final stage World War II was the war between two factions: the Allies including Britain, France, America and Russia, and the Fascism including Japan, Germany and Italy The Fascists ... dictatorial and cruel the Fascists are, where they are from, what their activities and goals are; how the French imperialists conquer and invade their colonies or what the nations are in the Allies… ... to the Japanese rather than the Japanese’s violation into Indochina It features the French crimes as they had been vocal about protecting Vietnam but in fact, sold our country to the Japanese Also,...

Ngày tải lên: 14/12/2013, 00:41

... modal in a certain situation makes clear which meaning is intended An effort has also been made to have a contrastive analysis of the meanings expressed via the modal verbs can, may, must and the ... in language B He considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical teaching ... with other verbs to create verb phrases in the sentence 1.4 Contrastive analysis (CA) As one of the main aims of this paper is to carry out a contrastive analysis on the meanings expressed via the...

Ngày tải lên: 29/01/2014, 00:23

... therefore advisable to use the sub-domains rather than the domains of the CHIPCE when evaluating ADHD patients This is supported by the factor analysis based on the sub-domains and the correlation analysis ... 340 Table Cronbach’s alpha (standardized) for the subdomains and the lowest alpha that was reached by deleting an item in that sub-domain with 95% CIs A Schacht et al Sub-domains At baseline At ... analysis Inclusion of patients receiving active treatment and placebo in the analysis over time will increase the range of the changes and will thus lead to a wider basis for the evaluation The...

Ngày tải lên: 12/02/2014, 19:20

... uproar, the chairman abandoned the attempt to take a vote Without a tear on her face, the girl watched him led away 3.2 Semantic roles of adverbial clauses One important way in which adverbial ... have main features of the whole family of adverbial clauses, that is, they perform the same semantic roles as the adverbial clause and as far as structure is concerned, they may also fall into ... or In order that, for fear that, in case So that Sothat, suchthat In the way (that) As if, as though as Asso, thethe Ratherthan, soonerthan CHAPTER IV: ADVERBIAL CLAUSES IN VIETNAMESE 24 Nguyn...

Ngày tải lên: 18/02/2014, 22:49

... proteinligand bonds when the two domains are taken apart On the other hand, simultaneous interaction of the two fragments domains with the sandwiched ligand had a cooperative character It leads to higher ... (Fig 6) All the above facts mean that the intestinal uptake of analogues can be quite feasible In this regard we plan to examine a group of analogues concerning details of their binding to the specic ... corresponds to change of absorbance at wavelength 352 nm in the reaction sample after incubation time t; DAmax ẳ jACNCbl AH2 OCbl j stands for maximal poss352 ible change in the amplitude at wavelength,...

Ngày tải lên: 19/02/2014, 05:20

... ịt ỵ A2 expkHX;2 ịt ỵ A3 where A1 , A2 , and A3 are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2 are the apparent exchange rate constants for the fast and slow amide ... conjugates were independent of the size of the glycan (Tables and 5, [36]) The analysis revealed that the changes in these parameters statistically correlate for both the acylation and deacylation ... scaled with the ith diagonal element of [uk]ii: ẵDRi ị2 k ẳ 3kB Tc1 ịkk ẵuk ii Statistical analysis All statistical analyses were performed by one-way analysis of variance (anova) with a P-value...

Ngày tải lên: 19/02/2014, 05:20

... described above for flow cytometry After establishing a scan area, the slides were analyzed using a 40 · objective and mW of Argon laser power The entire cell preparation was examined A cell gallery was ... may also be related to low formation of topoII-DNA complexes, which is generally associated with G2 arrest and the absence of programmed apoptotic death [5] Be that as it may, daunorubicin and ... TX, USA), and it was carried out within the framework of the Centre de Referencia en Biotecnologia (Generalitat de Catalunya) Sylvia Mansilla is recipient of a doctoral fellowship from the CIRIT...

Ngày tải lên: 20/02/2014, 23:20

... Delta States South East Afforestation from cropland Appalachia Afforestation from pasture Great Plains Corn Belt Tillage changes Lake States North East 50 100 150 200 MMT CO2e Source: Lewandrowski ... long-term analysis we assume the structure of the agricultural economy in the United States remains stable That is, the role of energy in agriculture remains the same over time The relation between ... between the medium and long term analyses and the short term analysis is that the EITE provisions are phased out beginning in 2025; thus, the full impact of higher natural gas prices are felt...

Ngày tải lên: 21/02/2014, 01:20

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline phosphatases at ... higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation of mutant and wild-type...

Ngày tải lên: 22/02/2014, 04:20

... GTCGGATC CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG The deletion was constructed ... of the primary rRNA transcript maturation As the analysis was carried out with D7 strains, we were concerned that the observed increased subunit association in the case of JB69 was an artefact ... follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT The resulting vector 1754 Selection of second-site rRNA suppressors of cold- sensitive IF1 A direct...

Ngày tải lên: 06/03/2014, 00:21