the first use of dental evidence in a court case

The Art of Grief The Use of Expressive Arts in a Grief Support Group pptx

The Art of Grief The Use of Expressive Arts in a Grief Support Group pptx

... meet the needs of the members and the facilitators is the initial planning, organization, and setting up of the group This initial stage can easily be bypassed in the interests of time and the ... logical relationship, and the feelings may come all at once in an inexplicable ball of raw emotion You may hear complaints of fatigue, exhaustion, lack of energy, pain, or inability to sleep All of ... Grief and the Sacred Art of Ritual Janet Shaw Rogers 129 Section III Alternative Art Forms, Programs, and Stories of Art and Healing Chapter 14 The Painters Deborah Koff-Chapin, Carol McIntyre, and...

Ngày tải lên: 29/03/2014, 04:20

324 639 0
Báo cáo y học: "Use of intravitreal bevacizumab in a patient with a Von Hippel-Lindau-associated retinal haemangioblastoma of the optic nerve head: a case report" docx

Báo cáo y học: "Use of intravitreal bevacizumab in a patient with a Von Hippel-Lindau-associated retinal haemangioblastoma of the optic nerve head: a case report" docx

... three intravitreal bevacizumab injections in a patient with VHL and a peripapillary retinal haemangioblastoma Treatment with ranibizumab in patients early in the course of their disease, who have ... Thompson DJ, Linehan WM, Ferris FL, Chew EY: Intravitreal anti-vascular endothelial growth factor therapy with pegaptanib for advanced von Hippel-Lindau disease of the retina Retina 2007, 27:150-158 ... hypoxia inducible factor degradation, inducing profound intracellular changes that resemble the changes observed after oxidative stress This results in increased levels of several factors including...

Ngày tải lên: 11/08/2014, 23:21

4 263 0
Báo cáo y học: " Exploring the optimum approach to the use of CT densitometry in a randomised placebo-controlled study of augmentation therapy in alpha 1-antitrypsin deficiency" pptx

Báo cáo y học: " Exploring the optimum approach to the use of CT densitometry in a randomised placebo-controlled study of augmentation therapy in alpha 1-antitrypsin deficiency" pptx

... EXACTLE trial was designed to explore the use of CT densitometry as an outcome measure for the assessment of plasma AAT augmentation therapy in individuals with AATD The analytical approach, and ... Talecris and participated in the design of the study, in the collection, analysis and interpretation of data (CD was the statistician for the study), in the writing of the manuscript and in the ... indicate a graded response to therapeutic augmentation of AAT The graded therapeutic effect that was most evident in the basal region may indicate that the progression of panlobular emphysema might...

Ngày tải lên: 12/08/2014, 14:20

10 439 0
Báo cáo y học: "The Nordic Maintenance Care Program – An interview study on the use of maintenance care in a selected group of Danish chiropractors" pdf

Báo cáo y học: "The Nordic Maintenance Care Program – An interview study on the use of maintenance care in a selected group of Danish chiropractors" pdf

... and three mentioned an interval of months They also mentioned that the timing of appointments would vary with the needs of the patient Duration of maintenance care program Aim of the maintenance ... standard management programs Rather, their responses indicated that maintenance care can be used for any type of low back pain with the intent of improving spinal function in order to avoid a ... consisted of a basic case, describing a hypothetical patient with low back pain The basic case was described as follows: "A 40-year old man who consults you for low back pain with no additional spinal...

Ngày tải lên: 13/08/2014, 14:20

7 420 0
Báo cáo sinh học: "Impact of the use of cryobank samples in a selected cattle breed: a simulation study" potx

Báo cáo sinh học: "Impact of the use of cryobank samples in a selected cattle breed: a simulation study" potx

... Figure 2), there was a per generation increase in genetic gain for trait B, while there was a slightly lower increase or even a decrease in genetic gain for trait A, as well as in average kinship, ... as parents of the male progeny, and 20 bulls and 10000 cows were chosen as parents of the female progeny (with no selection on the dam to dam path) Mating was random resulting in random variation ... cattle has led to an undesirable increase in inbreeding, as well as to the deterioration of some functional traits which are indirectly selected Semen stored in a cryobank may be a useful way...

Ngày tải lên: 14/08/2014, 13:21

28 245 0
Báo cáo sinh học: "Polymorphism of β-casein in the Creole goat of Guadeloupe: evidence for a null allele" doc

Báo cáo sinh học: "Polymorphism of β-casein in the Creole goat of Guadeloupe: evidence for a null allele" doc

... was ascertained in another family (male No 111) In the same flock, individuals had additional ’new’ /3-casein patterns In case (fig 1, sample 6) the (3-casein bands were lighter than normal, and ... mutants in that they are associated with less o in milk than the normal or strong alleles, a! l-CnA!B and C i-casein s The characterization of the protein variants was carried out by Brignon et al ... by sample in figure Because of the ’null’ individuals were offspring of the same male, No 15, the progeny of this sire was used to further investigate the inheritance of the ’null’ trait The...

Ngày tải lên: 14/08/2014, 19:22

6 294 0
Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt

Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt

... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Z Gajda, “On stability of additive mappings,” International Journal of Mathematics and Mathematical Sciences, vol ... functional equation,” Proceedings of the National Academy of Sciences of the United States of America, vol 27, no 4, pp 222–224, 1941 T Aoki, “On the stability of the linear transformation in Banach ... Ulam,” Journal of Approximation Theory, vol 57, no 3, pp 268–273, 1989 T M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical Society,...

Ngày tải lên: 22/06/2014, 06:20

15 363 0
Báo cáo lâm nghiệp: " Quantification of nutrient content in the aboveground biomass of teak plantation in a tropical dry deciduous forest of Udaipur, Indi" pdf

Báo cáo lâm nghiệp: " Quantification of nutrient content in the aboveground biomass of teak plantation in a tropical dry deciduous forest of Udaipur, Indi" pdf

... aboveground biomass of teak plantation, Udaipur, Rajasthan, India N Component Table Concentration of nutrients (% ± 1.s.e.) in the aboveground biomass of teak plantation, Udaipur, Rajasthan, India 1.79 ... with a maximum of 46.3°C and a minimum of 28.8°C during summers Winters are a little cold with the maximum temperature rising to 26.8°C and the minimum dropping to 2.5°C The average annual rainfall ... however, there is a lack of knowledge concerning the quantification of nutrient content in the aboveground biomass of teak plantation in a tropical dry deciduous forest of Rajasthan, western India Therefore,...

Ngày tải lên: 07/08/2014, 03:22

6 353 0
Báo cáo y học: "Variations in branching of the posterior cord of brachial plexus in a Kenyan population" ppsx

Báo cáo y học: "Variations in branching of the posterior cord of brachial plexus in a Kenyan population" ppsx

... drafting of the manuscript OJ was involved in revision and final approval of the manuscript version to be published All authors have read and approved the final manuscript Competing interests The ... 13.3% Page of population differences in anatomy of the brachial plexus This variant anatomy is important in explaining the outcome of attempted subscapular block in hemiplegic patients with painful ... cadavers This rare variation may be caused by the segmental origin of the axillary artery and its branching which may determine the arrangement of the brachial plexus during fetal development...

Ngày tải lên: 10/08/2014, 10:20

5 243 0
Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx

Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx

... 5'-CAACACUCGCAAUAUU-3'(sense) 3'-GUUGUGAGCGACGUUAUAA-5'(antisense) α3 domain 5'-AGGUCUUAUGGUGCUGUCAUU-3'(sense) 3'-UUUCCAGAAUACCACGACAGU5'(antisense) Transmembrane domain 5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense) ... GGTGCTGTCAC-3', Anti sense: 5'- TGT Page of 12 GTAATTCTGCTCCTTCC -3'; β-actin, Sense: 5'-TG GAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'TAAAACGCAGCTCAGTAACAGTCCG-3'; IFNγ, Sense: 5'-AGCGGCTGACTGAACTCAGATTGTAG ... 3'-UUACACUACUUAUCCUCCACU5'(antisense) Cytoplasmic membrane domain 5'-UAGAGCUCUGAUAGAUCUCUU-3'(sense) 3'-UUAUCUCGAGACUAUCUAGAG5'(antisense) France, Illkirchcedex), was intravenously injected into...

Ngày tải lên: 11/08/2014, 03:20

12 287 0
Báo cáo y học: "Diagnostic use of infrared thermography in a patient with chronic pain following electrocution: a case report" doc

Báo cáo y học: "Diagnostic use of infrared thermography in a patient with chronic pain following electrocution: a case report" doc

... reduction in pain from 8/10 to 4–5/10 using self-reported pain scales This reduction in pain was noted within weeks Although there was a reduction in pain after the administration of pregabalin, there ... allodynia in the anterior abdominal wall that was substantially higher on the left and extending upward to the rib cage down to the lower border of the L1 dermatome Clinical thermography was undertaken ... of clinical improvement, there was no change in the differential temperature of the left hand and foot This may indicate that, although central processing of pain can be reduced, the neural injury,...

Ngày tải lên: 11/08/2014, 14:20

4 455 0
báo cáo khoa học: " The first decade of antiretroviral therapy in Africa" doc

báo cáo khoa học: " The first decade of antiretroviral therapy in Africa" doc

... accessible at an affordable price as soon as they become available Challenges for the next phase of antretroviral delivery Ten years ago, global inaction against HIV/AIDS was labelled as a crime against ... antiretroviral therapy increased, so the broader benefits of ART became apparent In Malawi, adult mortality within the general population fell by a third as ART access increased [39], and similar declines ... HIV/AIDS has traditionally been managed by a range of specialists from dermatology to oncology, health centres in sub-Saharan Africa faced with a dominant proportion of the global AIDS burden have...

Ngày tải lên: 11/08/2014, 14:21

6 333 0
Báo cáo khoa học: "The first report of Aelurostrongylus falciformis in Norwegian badgers (Meles meles)" pps

Báo cáo khoa học: "The first report of Aelurostrongylus falciformis in Norwegian badgers (Meles meles)" pps

... melesi(lpg) female female male female male unknown female male male adult adult adult adult adult adult adult juvenile adult trauma trauma trauma trauma trauma trauma shot shot trauma Vestby Oslo ... some of the badgers, were set up in Baermann apparatus for hours and then examined for faecal larval burden, larvae per gram (lpg); the larvae collected were stored in 70% ethanol Larvae from the ... Cross-sections of adult Aelurostrongylus falciformis in the terminal airways of a Norwegian badger (Leica DC300 Digital Camera) Bar = 100µm compared to those found in the respiratory tract and faeces The adult...

Ngày tải lên: 12/08/2014, 18:21

4 273 0
Báo cáo khoa học: " Ruminal acidosis and the rapid onset of ruminal parakeratosis in a mature dairy cow: a case report" doc

Báo cáo khoa học: " Ruminal acidosis and the rapid onset of ruminal parakeratosis in a mature dairy cow: a case report" doc

... Acta Veterinaria Scandinavica 2009, 51:39 condition of ruminal parakeratosis The characteristics of ruminal parakeratosis include accumulated layers of keratinized, nucleated squamous epithelial ... not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:39 ventral sac of the rumen via the cannula immediately after the final day of the HF and HG treatments Rumen papillae biopsies ... stages of a grain-induced ruminal acidosis Case presentation A 10-year old, non-lactating Holstein dairy cow, fitted with a rumen cannula, was nutritionally induced to develop ruminal acidosis by increasing...

Ngày tải lên: 12/08/2014, 18:22

6 334 0
Developing critical capacities for the efficient use of public investments in infrastructure to support trade and economic development in vietnam

Developing critical capacities for the efficient use of public investments in infrastructure to support trade and economic development in vietnam

... acquisition and building capacity of local firms A model of the impacts of these factors on the efficient use of public investments in infrastructure was examined and validated Among these factors, ... investments in infrastructure in planning and delivery in Vietnam In addition, the chapter provides an understanding of the planning process at the national level, and major tasks of government agencies ... planning Details of approaches used for data analysis and data collection for this study are then discussed Chapter focuses on data analysis and discussion A model of the critical factors affecting...

Ngày tải lên: 10/09/2015, 09:01

392 562 0
Approximation to the stationary distribution of information flows in a communication network

Approximation to the stationary distribution of information flows in a communication network

... allocation The Max-min and Kelly’s proportional fairness allocations are then the special cases of the α allocation rule These fairness bandwidth allocation rules are critical to another important aspect ... such as the PANACEA is that it requires only renewal arrivals rather than Poisson arrivals as in the other solvers, thus the modelling error is largely eliminated The drawback is that it assumes ... isolated queue is not statically separated from the others but rather dynamically linked in the estimation of the processing capacity 1.3 Research contribution As we have mentioned, the data transmitting...

Ngày tải lên: 30/09/2015, 14:16

98 418 0
The first use of cheese as food is not known

The first use of cheese as food is not known

... manipulation of a variety of factors including: The kind of milk used = cow, sheep, goat, buffalo, reindeer, camel, yak, etc The curding, cutting, cooking, and forming methods The type of bacteria or ... micro-organisms is available for vegetarian cheeses • Fermenting to form lactic acid • Adding acid (e.g lemon juice, lime juice or vinegar) • Boiling or • Using plant extracts (e.g papaya sap (papain ... the smaller, milled curd pieces are put back in the vat and salted by sprinkling dry salt on the curd and mixing in the salt In some cheese varieties, such as mozzarella, the curd is formed into...

Ngày tải lên: 11/01/2016, 17:04

11 176 0
The changing role of managerial accounting in a dynamic business environment

The changing role of managerial accounting in a dynamic business environment

... Financial Accounting Accounting Accounting System System (accumulates (accumulates financial financial and and managerial managerial accounting accounting data data in in the the cost cost accounting ... making making and and planning planning •• Assisting Assisting managers managers in in directing directing and and controlling controlling activities activities •• Motivating Motivating managers ... controlling an an organization’s organization’s operations operations Internal Users Financial Financial Accounting Accounting Published Published financial financial statements statements and and other...

Ngày tải lên: 05/12/2016, 17:29

31 433 0
w