the federal reserve act of 1913 guaranteed a substantial measure of public

The World Bank’s Genuine Savings Indicator: a Useful Measure of Sustainability? pptx

The World Bank’s Genuine Savings Indicator: a Useful Measure of Sustainability? pptx

... more than compensate for depreciation of human made capital and depreciation of natural capital there. But how is depreciation of natural capital caused by the Japanese economy around the world ... for the depreciation of natural capital which produce magic numbers. Thus the economy of Japan appears at the top of the league in tables on weak sustainability because savings are very high and ... less can they be given a money value. Weak sustainability not only makes the doubtful assumption that human made capital can be substituted for natural capital it is also based on calculation...

Ngày tải lên: 29/03/2014, 09:20

10 320 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACA ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG pGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG pEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT pEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG pYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2...

Ngày tải lên: 19/02/2014, 05:20

14 517 0
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

... indicated. Table 3. Quantitative evaluation of thiol and disulfide containing pep- tides of aerobically and anaerobically prepared apoFNR. Aerobically or anaerobically prepared apoFNR were incubated ... rapid (Fig. 6). ApoFNR formation is the counterpart to the disappearance of [2Fe-2S]ặFNR in the bacteria [16]. The presence of significant amounts of apoFNR in the bacteria has to be demonstrated, ... function and properties of the protein. Therefore the redox state of the cysteinyl residues of the various forms of apoFNR – ‘aerobic’ and ‘anaer- obic’ apoFNR, and apoFNR obtained by air-induced inactivation...

Ngày tải lên: 23/03/2014, 15:20

10 477 0
Tài liệu IN PLAIN ENGLISH: MAKING SENSE OF THE FEDERAL RESERVE pptx

Tài liệu IN PLAIN ENGLISH: MAKING SENSE OF THE FEDERAL RESERVE pptx

... www.frbatlanta.org Federal Reserve Bank of Boston www.bos.frb.org Federal Reserve Bank of Chicago www.chicagofed.org Federal Reserve Bank of Cleveland www.clevelandfed.org Federal Reserve Bank of Dallas ... monetary policy and oversees the activities of Reserve banks. Board oF governors making sense OF THE FEDERAL RESERVE 3 THE FEDERAL RESERVE SYSTEM isit a Federal Reserve bank, and you’ll see that ... halfway through! Now that you know who we are at the Federal Reserve 1) the Board of Governors, as the federal government agency; 2) the Reserve banks, as the operational arms; and 3) the...

Ngày tải lên: 16/02/2014, 12:20

22 531 0
Tài liệu Office of the Comptroller of the Currency Board of Governors of the Federal Reserve System pptx

Tài liệu Office of the Comptroller of the Currency Board of Governors of the Federal Reserve System pptx

... of the Treasury Making Home Affordable MHA HAMP, the Department of Housing and Urban Development Federal Housing Administration FHA HAMP, the Department of Veteran Affairs VA HAMP, the Department ... there is no more recent appraisal or BPO available since the origination of the loan, the estimated value of the home at the time of error will be based on the estimated value of the home at ... Framework Approach 1. What is the purpose of the Financial Remediation Framework? The Office of the Comptroller of the Currency (OCC) and the Board of Governors of the Federal Reserve System...

Ngày tải lên: 17/02/2014, 21:20

13 362 0
Board of Governors of the Federal Reserve System Federal Deposit Insurance Corporation Office of the Comptroller of the Currency potx

Board of Governors of the Federal Reserve System Federal Deposit Insurance Corporation Office of the Comptroller of the Currency potx

... variables to one another. Sensitivity analysis can also help to assess a combined impact on a banking organization of several variables, parameters, factors, or drivers. For example, a banking ... banking organization’s capital position, including regulatory and other capital ratios. There should also be consideration of the impact on the banking organization’s allowance for loan and ... given greater or lesser weight, analyze the combined impact of its tests, and then evaluate potential courses of action based on that analysis. A banking organization may decide to maintain its...

Ngày tải lên: 06/03/2014, 03:20

18 607 0
Secrets of the federal reserve

Secrets of the federal reserve

... monopoly of the note issue. This is the key to its power. Also, the act of establishing a central bank has a direct inflationary impact because of the fractional reserve system, which allows the creation ... private secretary, Shelton; A. Piatt Andrew, Assistant Secretary of the Treasury, and Special Assistant of the National Monetary Commission; Frank Vanderlip, president of the National City Bank of ... had also replaced him as president of the First National Bank of Chicago when Forgan was named chairman of the board. Representing the New York Federal Reserve district on the first Federal Advisory...

Ngày tải lên: 09/04/2014, 16:36

153 423 1
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... autoradiographed. Competitor DNAs used in EMSA analysis were: NF1 wt, 5Â-TTTTG GATTGAAGCCAATATGATA-3Â;NF1mut,5Â-TTTT GGATTGAATAAAATATGATA-3Â;Site-2wt,5Â-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3Â;Site-2mut,5Â-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3Â;Site-3wt, 5Â-GGGTTCTTTTGGCATCCCTGTAGC-3Â;Site-3mut, 5Â-GGGTTCTTTTTAAATCCCTGTAGC-3Â. Chromatin ... 91 Bratislava, Slovak Republic. Fax: + 421 259327250, Tel.: + 421 259327110, E-mail: Katarina.Luciakova@savba.sk Abbreviations: ANT, adenine nucleotide translocase; NF1, nuclear factor 1; CAT, ... )525 (5Â-TGACCTTGTCTCGTTGCCTCACCC-3Â)and)378 (5Â-GCTACAGGGATGCCAAAAGAACCC-3Â)forthe Site-3, and primer set )346 (5Â-GCGTCTCACCCTAGT CCTGGTCCTGC-3Â)and)214 (5Â-GGAAGGGGCGGG TCCAGAGAACA-3Â) for the Site-2 element. PCR was performed...

Ngày tải lên: 07/03/2014, 15:20

8 426 0
Marketing of Vice Goods: A Strategic Analysis of the Package Size Decision pdf

Marketing of Vice Goods: A Strategic Analysis of the Package Size Decision pdf

... Amaldoss; Ram Janakiraman; Ambar Rao; seminar participants at the University of Arizona, University of British Columbia, University of Texas at Austin, University of Texas at Dallas, and Washing- ton ... unit in a large package. In this case, note that two small packages are equivalent to a large package. 14 With this assumption, the analysis with small packages is sim- ilar to the case when the ... necessary. Furthermore, it is not necessary that margins for the small package be dou- ble the margins for the small package. This is because the increase in the sales of small packages compen- sates...

Ngày tải lên: 16/03/2014, 11:20

16 488 0
The Federal Reserve’s Commercial Paper Funding Facility potx

The Federal Reserve’s Commercial Paper Funding Facility potx

... funds rate was a range, then the loan was set at the maximum rate within that range. 26 The Federal Reserve s Commercial Paper Funding Facility Source: Board of Governors of the Federal Reserve ... issuance, and the SPV paid the Federal Reserve Bank of New York the principal and interest on its loan, set at the federal funds target on the original loan date. 16 Because the custodian bank, ... primary dealers as agents to the transactions between the Fed and commercial paper issuers. Primary dealers actively underwrite, place, and make markets in the commercial paper market, and they...

Ngày tải lên: 23/03/2014, 12:21

15 379 0
The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot

The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot

... agrees to a below-market interest rate in exchange for a share of the appreciated value of the collateral property. The share of the appreciated value is determined and due at the sale of the property ... from the GSEs (guaranteed mortgage-backed securities issued by Freddie Mac and Fannie Mae, as well as advances made by the Federal Home Loan Banks). To further support the availability of mortgage ... decide on the appropriate composition of the on- and o-balance-sheet activities allowed by banks to ensure adequate liquidity, capital, and duration match of assets and liabilities. A balance must...

Ngày tải lên: 29/03/2014, 07:20

51 468 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

... synthesis by insulin over a wide range of activities of phosphorylase a; (b)that suppression of GSK-3 activity, in the absence of inactiva- tion of phosphorylase, causes a large activation of ... stimulation of glycogen synthesis by insulin and phosphorylase inactivation are greater than can be explained by activation of glycogen synthase In view of the above findings that inactivation of phosphorylase ... of the phosphorylase inactivator, we suggest that additional factors may be involved in translocation of glycogen synthase and that phosphorylase a itself may be an important determinant of the...

Ngày tải lên: 31/03/2014, 01:20

9 381 0
Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

... demonstrated the absence of negatively charged oligosaccharide derivatives in all fractions (data not shown). ESI-MS of fractions PNGaseF-PA, PNGaseA-PA and Hyd(HFA)-PA (Fig. 2B–D) revealed the presence ... fractions were separately pyridylaminated and designated endoH-PA, PNGaseF-PA, PNGaseA-PA and Hyd(HFA)-PA, respect- ively. Analytical anion-exchange HPLC of the pyridyl- aminated oligosaccharide pools ... Amsterdam. 48. Takahashi, N., Hitotsuya, H., Hanzawa, H., Arata, Y. & Kur- ihara, Y. (1990) Structural study of asparagine-linked oligo- saccharide moiety of taste-modifying protein, miraculin....

Ngày tải lên: 31/03/2014, 08:20

15 482 0
w