the efficacy of a multiprofessional approach

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

... by the American Foundation for AIDS Research (amfAR) Grant 02882-32-RGV, National Institutes of Health Grant AI054183 to R.M.R, National Institutes of Health Grant AI078779 to F.R.F and National ... Directed antigen delivery as a vaccine strategy for an intracellular bacterial pathogen Proc Natl Acad Sci USA 2006, 103:5102-5107 10 Roberts DM, Nanda A, Havenga MJ, Abbink P, Lynch DM, Ewald BA, ... in parentheses for each group All Lmdd-gag vaccinations were preceded by oral administration of saturated sodium bicarbonate D-ala (640 mg/kg) was co-administered intravenously before and after...

Ngày tải lên: 11/08/2014, 08:21

7 394 0
Báo cáo y học: " Assessing the efficacy of a modified assertive community-based treatment programme in a developing country" potx

Báo cáo y học: " Assessing the efficacy of a modified assertive community-based treatment programme in a developing country" potx

... statistical analysis UB prepared the first draft of the manuscript and PO and LK made significant contributions to the final draft All authors read and approved the final manuscript Botha et al ... coordination of medication issuing One major disadvantage of the teams’ location was the historical, custodial reputation of state institutions The team therefore had to work harder to challenge ... patients dropped out during the course of the study Statistical Analysis All data were entered into a single, electronic database Statistical Analysis was done with Statistica version software...

Ngày tải lên: 11/08/2014, 16:22

8 310 0
báo cáo hóa học:" Enhancing the efficacy of cisplatin in ovarian cancer treatment – could arsenic have a role" potx

báo cáo hóa học:" Enhancing the efficacy of cisplatin in ovarian cancer treatment – could arsenic have a role" potx

... Chemotherapy The most active chemotherapy agents in ovarian cancer are the platinum analogues, cisplatin and carboplatin The antitumor activity of cisplatin (cis-diamminedichloroplatinum (II)) was ... Pharmacokinetic rationale for peritoneal drug administration in the treatment of ovarian cancer Canc Treat Rep 1978, 62:1-11 Markman M: Intraperitoneal chemotherapy in the management of malignant disease ... methods of enhancing the activity of cisplatin Ovarian cancers that are resistant to platinum therapy are either innately resistant, shown by a lack of response to front-line therapy, or develop platinum...

Ngày tải lên: 20/06/2014, 07:20

7 504 0
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc

Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc

... equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl ... doi:10.1186/1029-242X-2011-82 Cite this article as: Bae and Park: A fixed-point approach to the stability of a functional equation on quadratic forms Journal of Inequalities and Applications 2011 2011:82 Page of ... : = ax2 + bxy + cy2 is a solution of the Equation 1.1 The authors [12] acquired the general solution and proved the stability of the functional Equation 1.1 for the case that X and Y are real...

Ngày tải lên: 20/06/2014, 22:20

7 429 0
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx

Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx

... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Th M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical ... “On the stability of the linear transformation in Banach spaces,” Journal of the Mathematical Society of Japan, vol 2, pp 64–66, 1950 D G Bourgin, “Classes of transformations and bordering transformations,” ... Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 12 S.-M Jung and P K Sahoo, “Stability of a functional equation...

Ngày tải lên: 22/06/2014, 11:20

7 257 0
Báo cáo hóa học: " Research Article A Fixed Point Approach to the Stability of a Volterra Integral Equation" pptx

Báo cáo hóa học: " Research Article A Fixed Point Approach to the Stability of a Volterra Integral Equation" pptx

... paper, we will adopt the idea of C˘ dariu and Radu [12] and prove the Hyersa Ulam-Rassias stability and the Hyers-Ulam stability of the Volterra integral equation (1.2) Hyers-Ulam-Rassias stability ... 143–190, 1995 [5] P G˘ vruta, A generalization of the Hyers-Ulam-Rassias stability of approximately additive a ¸ mappings,” Journal of Mathematical Analysis and Applications, vol 184, no 3, pp ... Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 [11] J B Diaz and B Margolis, A fixed point theorem of the...

Ngày tải lên: 22/06/2014, 19:20

9 278 0
Báo cáo khoa học: "The Safety and efficacy of a new self-expandable intratracheal nitinol stent for the tracheal collapse in dogs" ppt

Báo cáo khoa học: "The Safety and efficacy of a new self-expandable intratracheal nitinol stent for the tracheal collapse in dogs" ppt

... located from the mid-cervical to the thoracic trachea increased the diameter of the entire cervical to thoracic tracheal area Coughing and dyspnea disappeared and the dogs resumed normal activity ... female, CT‐TT: cervical trachea to thoracic trachea Fig Lateral radiographs before (a) and after (b) intratracheal placement of self expandable nitinol stent with flare ends in a dog with tracheal ... to fit an individual trachea or bronchus Once implanted into the trachea or bronchus, the stent retains the same external diameter and increases the rigidity of the tracheobronchial wall The nitinol...

Ngày tải lên: 07/08/2014, 20:23

3 576 0
báo cáo khoa học: "The efficacy of preopoerative instruction in reducing anxiety following gyneoncological surgery: a case control study" pptx

báo cáo khoa học: "The efficacy of preopoerative instruction in reducing anxiety following gyneoncological surgery: a case control study" pptx

... what they will have to face on the operation day, such as the characteristics of the operating theatre, and the medical procedures before they fall asleep because of the effect of anesthesia ... in the State-Trait Anxiety Inventory are considered as “high anxiety level” 2.5 Evaluation of the Data Data obtained in the study were evaluated on the computer using SPSS package program The ... medical characteristics which are thought to have an impact on anxiety were addressed, as well Approval of the hospital training, planning and coordination ethical committee was obtained for the...

Ngày tải lên: 09/08/2014, 01:24

8 366 2
Báo cáo khoa học: "Intensity-Modulated Radiotherapy for Squamous Cell Carcinoma of the Anal Canal: Efficacy of a Low Daily Dose to Clinically Negative Regions" ppsx

Báo cáo khoa học: "Intensity-Modulated Radiotherapy for Squamous Cell Carcinoma of the Anal Canal: Efficacy of a Low Daily Dose to Clinically Negative Regions" ppsx

... Intensity-Modulated Radiotherapy for Squamous Cell Carcinoma of the Anal Canal: Efficacy of a Low Daily Dose to Clinically Negative Regions Jason A Call1, Michael G Haddock1, J Fernando Quevedo2,David W Larson3, ... Benson AB 3rd, Thomas CR Jr, et al Fluorouracil, mitomycin, and radiotherapy vs fluorouracil, cisplatin, and radiotherapy for carcinoma of the anal canal: a randomized controlled trial JAMA 2008 Apr ... chemotherapy and radiotherapy Such therapy, delivered in a neoadjuvant fashion, decreased the failure rate compared with that of surgery alone (14,15) This ultimately led to a primary approach of...

Ngày tải lên: 09/08/2014, 09:21

19 375 0
Báo cáo y học: "A meta-analysis of the efficacy of fibromyalgia treatment according to level of care" pptx

Báo cáo y học: "A meta-analysis of the efficacy of fibromyalgia treatment according to level of care" pptx

... and meta-analysis of all randomised controlled trials (RCTs) of pharmacological and non-pharmacological treatments that are available in standard primary care settings and those that are administered ... made up of middle-aged women, with an average duration of the disorder of six to 10 years, mainly treated with pharmacological approaches Most of the studies were carried out in the USA Page of ... primary and specialised levels of care Two of the variables that improve treatment efficacy in fibromyalgia are low quality of the studies and shorter duration of Available online http://arthritis-research.com/content/10/4/R81...

Ngày tải lên: 09/08/2014, 10:23

15 531 0
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx

báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx

... Scientific Software Development GmBH, Berlin, Germany), a qualitative data management software [58], will be used to manage and analyze all qualitative data Quantitative analysis All tests will ... language (e.g., Spanish) to reduce language barriers and drafting all patient educational materials at the appropriate reading level (e.g., fourth grade) to enhance health literacy Surface adaptations ... calculates the proportion of appropriate services obtained [18] Health and mental health-related quality of life SF-12 [75], a self-report measure available in English and Spanish and validated...

Ngày tải lên: 10/08/2014, 11:20

12 423 0
Báo cáo y học: "A case-series study to explore the efficacy of foot orthoses in treating first metatarsophalangeal joint pain" pot

Báo cáo y học: "A case-series study to explore the efficacy of foot orthoses in treating first metatarsophalangeal joint pain" pot

... contributed to the data analysis and writing of the manuscript AMK contributed to the study design, clinical and laboratory investigations and to the data analysis and writing of the manuscript ACR contributed ... attached at the anatomical landmarks and with the Velcro fastening, neoprene boot secured, which was used during the capture of kinematic data Efficacy analysis Exploratory analysis Following the ... for Windows The analysis strategy was divided into two phases, an efficacy phase and an exploratory phase For the efficacy analysis, comparisons of pain scores between baseline and primary endpoint...

Ngày tải lên: 10/08/2014, 21:24

9 451 0
Báo cáo y học: "A randomized, double-blind, placebo-controlled trial to assess the efficacy of topiramate in the treatment of post-traumatic stress disorder" pot

Báo cáo y học: "A randomized, double-blind, placebo-controlled trial to assess the efficacy of topiramate in the treatment of post-traumatic stress disorder" pot

... the amygdala indicative of a reduced GABA release and/or increased GABA uptake from the extracellular space Clinical studies with topiramate suggest that it is effective as monotherapy or adjunctive ... Secondary research goals includes studying the efficacy of topiramate in social adjustment, functioning and quality of life Additionally, evaluating treatment adhesion, and studying the efficacy of ... gave a global score, as specific areas scores: functional capacity, physical aspects, pain, general health condition, vitality, social aspects and emotional aspects, and mental health Page of...

Ngày tải lên: 11/08/2014, 17:20

7 588 0
Báo cáo y học: " Comparison of the efficacy of lamivudine and telbivudine in the treatment of chronic hepatitis B: a systematic review" pdf

Báo cáo y học: " Comparison of the efficacy of lamivudine and telbivudine in the treatment of chronic hepatitis B: a systematic review" pdf

... varies greatly in different parts of the world Based on the prevalence of HBV surface antigen(HBsAg) carrier rate in the general population, sub-Saharan African, East Asian and Alaskan populations ... 2010), the Cochrane Central Register of Controlled Trials and the Cochrane Database of Systematic Review Of these databases, CNKI, WANFANG and VIP databases provide literatures in Chinese The search ... made substantial contributions to its design, acquisition, analysis and interpretation of data LZC, and XHD, participated in the design, acquisition, analysis and interpretation of data All authors...

Ngày tải lên: 12/08/2014, 01:21

11 398 0
Báo cáo y học: "Efficacy of a progressive walking program and glucosamine sulphate supplementation on osteoarthritic symptoms of the hip and knee: a feasibility trial" pot

Báo cáo y học: "Efficacy of a progressive walking program and glucosamine sulphate supplementation on osteoarthritic symptoms of the hip and knee: a feasibility trial" pot

... statistical analysis All authors participated in the interpretation of the data and the drafting of the manuscript, and all authors read and approved the final manuscript Competing interests All authors ... Impact of Arthritis on Australia in 2007 Sydney: Arthritis Australia 2007 Access Economics: The Prevalence, Cost, and Burden of Disease of Arthritis in Australia Canberra, Australia: The Arthritis ... number of days walked during each of the 12 weeks of the Stepping Out program and on the mean number of steps walked per ‘walking’ day during that time Type and usage of rescue analgesia were also...

Ngày tải lên: 12/08/2014, 11:23

15 260 0
Báo cáo y học: " Control of allergic rhinitis and asthma test – a formal approach to the development of a measuring tool" ppt

Báo cáo y học: " Control of allergic rhinitis and asthma test – a formal approach to the development of a measuring tool" ppt

... Luciano Margarida Trindade Rita Câmara Rodrigo Alves Additional file CARAT – Control of Allergic Rhinitis and Asthma Test This is a translation to English of the of the preliminary version of ... meeting of the Formal Consensus Process Ana Arrobas Ana Todo-Bom Ângela Gaspar Aurora Carvalho Carlos Alves Carlos Lopes Fernando Calvário Authors' contributions LNS participated in data collection, ... reviewed the manuscript, ACP participated in the study design and manuscript writing, JAF is responsible for the CARAT project and participated in all stages and tasks All authors have read and approved...

Ngày tải lên: 12/08/2014, 14:20

9 370 0
Báo cáo y học: "Evaluating the efficacy of sequential biologic therapies for rheumatoid arthritis patients with an inadequate response to tumor necrosis factor-a inhibitor" ppsx

Báo cáo y học: "Evaluating the efficacy of sequential biologic therapies for rheumatoid arthritis patients with an inadequate response to tumor necrosis factor-a inhibitor" ppsx

... mean age, baseline DAS28; duration of follow-up (months); and key study findings Abbreviations ABA: abatacept; ACR: American College of Rheumatology; ADA: adalimumab; ANA: anakinra; CRP: C-reactive ... (adalimumab, etanercept and infliximab) On the basis of the greatest availability of data and relevance as markers of clinical response, the following efficacy measures were selected: ACR20, ACR50 ... College of Rheumatology; DAS28, Disease Activity Score 28 joint count; EULAR, European League Against Rheumatism ABA, abatacept, ADA, adamlimumab, ANA, anakinra, ETN, etanercept, GLM, golimumab,...

Ngày tải lên: 12/08/2014, 15:22

15 379 0
Báo cáo y học: "Evaluating the efficacy of sequential biologic therapies for rheumatoid arthritis patients with an inadequate response to tumor necrosis factor-a inhibitor" pps

Báo cáo y học: "Evaluating the efficacy of sequential biologic therapies for rheumatoid arthritis patients with an inadequate response to tumor necrosis factor-a inhibitor" pps

... performance criteria of the AntidsDNA-NcX ELISA with those of other assays for measuring antibodies against dsDNA and/or nucleosomes, Page of the new ELISA was compared with the anti-dsDNA ELISA, the ... curve (AUC) were calculated using GraphPad Prism software (GraphPad, La Jolla, CA, USA) Statistical analysis regarding autoantibody test results and disease variables obtained from medical records ... anti-dsDNA antibodies are always associated with antinucleosome antibodies (ANuA), but not vice versa, and that ANuA are exhibited prior to anti-dsDNA antibodies So, it also became clear that the mass...

Ngày tải lên: 12/08/2014, 15:22

9 455 0
Báo cáo sinh học: " A linear programming approach for estimating the structure of a sparse linear genetic network from transcript profiling data" pdf

Báo cáo sinh học: " A linear programming approach for estimating the structure of a sparse linear genetic network from transcript profiling data" pdf

... the class of linear models, the abundance value of a gene is treated as a weighted sum of the abundance values of other genes A high-dimensional transcript profile is a vector of abundance values ... is regulated often by a small number of other genes [3,4] so a reasonable representation of a network is a sparse graph A sparse graph is a graph  parametrized by a sparse matrix W, a matrix with ... based on a positive class of linear functions and the other on a general class of linear functions The accuracy of this LP-based approach for deducing the structure of networks is assessed statistically...

Ngày tải lên: 12/08/2014, 17:20

15 392 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

... COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and gene expression analyses Nine rabbits were euthanized weeks after either Link N or saline injection, and ... program for MATLAB software (Natick, MA, USA) by an orthopedic researcher who was blinded to the treatment groups The average of the disc height index (DHI) was calculated as a ratio of the average ... Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 Reverse: TCCTGGAAGATGGTGATG expression of the Link N-treated discs was normalized to saline-treated discs Biochemical analysis...

Ngày tải lên: 12/08/2014, 17:22

9 402 0
w