the dialectic of theory and clinic by robert hughes and kareen ror malone
Removal of arsenic from synthetic groundwater by adsorption using the combination of laterite and ironmodified activated carbon
Ngày tải lên :
05/09/2013, 09:38
... described by Langmuir isotherm and the adsorption capacities were 0.48mg/g and 1.18mg/g, respectively, as shown in the value of q0 of Langmuir isotherm Figure and Figure are non-linear plots of the ... and atmospheric condition The samples were taken then acidified and analyzed for residual arsenic concentration A mixture of 70% As[III] and 30% As[V] was used in all of the experiments and the ... while the surface of the original AC seems to be clean (Figure 1a on left side), there are some patches of iron particles stuck on the surface of AC-Fe (Figure 1b on right side) These may be the...
- 12
- 529
- 0
Tài liệu THE SECRETS OF SUCCRESS AND HAPPYNESS - By Jack Brannigan ppt
Ngày tải lên :
22/12/2013, 19:15
... your advantage by themselves; most of the time, you must make them happen Play the game of life with the attitude of playing to win and not with the attitude of playing not to lose The following ... side, when these people retire, they quickly deteriorate because they lack the stimulus of their work While they were so fully and constantly occupied with their work and career, they never developed ... people have done the most with the opportunities in their lives, they just seem luckier Often their luck has been recorded, and one can go back and look at it and say, “Yes there it is This guy...
- 23
- 497
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
Ngày tải lên :
14/02/2014, 19:20
... solution of ThT and the fluorescence intensity of the solution was measured at 482 nm Figure 4A shows the kinetics of aggregation of a-synuclein in the presence of 100 lm MPTP and the effect of 50 ... (D), in the presence of 200 lM MPP+ (E), in the presence of 100 lM MPTP and 50 lM dopamine (F), in the presence of 200 lM MPTP and 50 lM dopamine (G), in the presence of 100 lM MPP+ and 50 lM ... signals were quantified by integrating the peak of interest using the software LC solution version 1.22 SP1 supplied by the manufacturer The concentrations of MPTP and MPP+ in the samples were calculated...
- 11
- 754
- 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
Ngày tải lên :
15/02/2014, 13:20
... Control and Prevention The role of BCG vaccine in the prevention and control of tuberculosis in the United States: a joint statement by the Advisory Council for the Elimination of Tuberculosis and the ... variable and equivocal The concern of the public health community about the resurgence and changing nature of TB in the United States prompted a re-evaluation of the role of BCG vaccination in the ... reviewed the results of 14 clinical trials and 12 casecontrol studies (41 ) The meta-analysts used a random-effects regression model to explore the sources of the heterogeneity in the efficacy of the...
- 27
- 1.3K
- 3
Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx
Ngày tải lên :
20/02/2014, 11:20
... Australia and is in accordance with the Australian Code of Practice for the care and use of animals for scientific purposes as well as the guidelines published by the National Institutes of Health, ... by normal (h) and Fe-loaded (s) hepatocytes as a percentage of the total, over 0–2 h uptake Effect of chelators and Fe status on subcellular distribution of NTBI in hepatocytes The effect of the ... slightly The hepatocytes exhibited similar characteristics Effect of chelators on uptake of NTBI The effects of the chelators on NTBI uptake by hepatocytes and Q7 hepatoma cells were marked and similar...
- 10
- 545
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
Ngày tải lên :
07/03/2014, 09:20
... J Borloo et al A B C D other Statistical analysis (Student’s t-test) between the MR-1R values and the sum of the values of the omcA– and the omcB– mutants revealed that there is no statistically ... which the reduction potential and the topology and accessibility of the presented metal play crucial roles in terms of binding efficiencies and subsequent reduction by the appropriate enzyme The ... Construction of the omcA– and omcB– single mutants and of the omcA– omcB– double mutant strains of MR-1 Single omcA– and omcB– mutants and a double omcA– omcB– mutant strain of MR-1 were generated by insertional...
- 11
- 731
- 0
Báo cáo khoa học: The expression of retinoblastoma and Sp1 is increased by low concentrations of cyclin-dependent kinase inhibitors ppt
Ngày tải lên :
16/03/2014, 23:20
... autoradiographs of the amplified products and the quantification of the bands is shown in the bottom panels Rb and Sp1 mRNA levels were determined from the ratio of the intensities between the Rb or Sp1 and the ... annealing of primers to nontarget DNA The lower solution contained the cDNA, the MgCl2, the dNTPs, the [32P]dATP[aP] and one half of the buffer, and the upper solution contained the four primers, the ... sequences of the dhfr and aprt genes The top panel of the figure corresponds to a representative autoradiograph of the amplified products, and quantification of the bands is shown in the bottom...
- 14
- 486
- 0
Báo cáo khoa học: Insights into the activation of brain serine racemase by the multi-PDZ domain glutamate receptor interacting protein, divalent cations and ATP ppt
Ngày tải lên :
30/03/2014, 03:20
... GAP2 together with PDZ7 Interestingly, in the absence of additional ATP, the activation induced by the presence of the PDZ4PDZ5-PDZ6-GAP2-PDZ7-end of GRIP reached the highest value The conformational ... sequencing Then, they were double digested with NdeI plus SalI and ligated into the corresponding sites of pCWori In all cases, the hexa-His was at the N-terminal end of the protein and the FLAG ... referred to as GAP1 and GAP2 (Fig 2A) Binding of GRIP to SR occurs through the direct interaction of the PDZ6 domain of GRIP and the final four amino acids of SR [12] We performed the recombinant...
- 11
- 286
- 0
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf
Ngày tải lên :
30/03/2014, 04:20
... 2.5 h, the thickness increased by 0.212 nm, the mass increased by 0.05 ngÆmm)2 and the density decreased by 0.0167 gÆcm)3, from the start of the experiment By the end of the measurement, the thickness ... during the entire experiment (Fig 5), i.e the thickness of the layer decreased by 0.014 nm, the layer density decreased by only 0.0086 gÆcm)3, and the mass decreased by 0.03 ngÆmm)2 The process of ... fluorescence The subsequent plateau phase is associated with a decrease in the concentration of small species, or the aggregation and precipitation of fibrils [37] The kinetics of these three stages of the...
- 16
- 577
- 0
the principles of light and color by edwin d babbitt (1878)
Ngày tải lên :
04/06/2014, 12:35
... things in their basic principles resemble all other things, and we are safe in judging of the unknown by the known, of the invisible by the visible, and of the whole by a part Great and important ... which stands at the refined end of the scale, and prevails in the soft depths of the sky, the ocean and the whole world of foliage, although the foliage combines yellow with the blue, and presents ... as one of the greatest of all errors and which has kept the true knowledge of atoms and all other departments of nature in the back ground, is the one sidedness of the prevailing theories of force...
- 287
- 647
- 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx
Ngày tải lên :
18/06/2014, 16:20
... early studies of our group and others, the transcriptional regulatory sequences of the H19 and IGF2 genes emerged as candidates for cancer targeted therapy H19 and IGF2 (the human P3 and P4 promoters) ... CAGCAATGCAGCACGAGGCGAAGCC) was designed to bind the 3’ end of exon and the 5’ end of exon without the introns in between The integrity of the cDNA was assayed by PCR analysis of the ubiquitous, cell cycle independent, ... reflected by measuring the size of the tumors and by bladders weight Tumor area of each bladder was macroscopically determined, using the ImagePro Plus software for measurement and analysis of the...
- 18
- 746
- 0
báo cáo hóa học: " Review of “Healing the Herds: Disease, Livestock Economies, and the Globalization of Veterinary Medicine” edited by Karen Brown and Daniel Gilfoyle" doc
Ngày tải lên :
21/06/2014, 02:20
... technologies in general by colonial administrations as a means to exploit resources The crop, forestry, water, fisheries, and other sectors all employed the modern technologies of the day, and if so, veterinary ... pastoralism and often view these areas as problems to be solved by modernization and settlement To some extent, the anti-pastoralist statements of current African policy makers seem even more extreme and ... Catley: Review of “Healing the Herds: Disease, Livestock Economies, and the Globalization of Veterinary Medicine” edited by Karen Brown and Daniel Gilfoyle Pastoralism: Research, Policy and Practice...
- 2
- 244
- 0
The Psychology of Money and Public Finance by Günter Schmölders (Dec 12, 2006)_2 pot
Ngày tải lên :
21/06/2014, 08:20
... him; he is the head of the family and the head of the house, the family bears his name, he represents the household to the outside world, he earns the larger part of the money with which the household ... household the income of the person who heads up that household and represents it to the outside world, who determines the social status of the other members of the household, i.e the income of the ... 3.1.1 The head of the house and the housewife When it comes to money management, then I cannot approve of the approach taken by most men of standing, who give their spouse a certain sum which they...
- 27
- 301
- 0
The Psychology of Money and Public Finance by Günter Schmölders (Dec 12, 2006)_3 docx
Ngày tải lên :
21/06/2014, 08:20
... terms of standard of living and the schedule of purchases for the households, a particular class of consumer goods played a special part at the time of the survey: the labour-saving products of ... stage of explanation, the further development of monetary theory is aimed at the goal of prediction Here we must go beyond the stimulus–response relation of our descriptive stage and search for the ... with expanding facilities of electronic data processing the stage is set for a confrontation between the various factions of monetary theory The heart of the question seems to be whether the general...
- 27
- 291
- 0
The Psychology of Money and Public Finance by Günter Schmölders (Dec 12, 2006)_4 doc
Ngày tải lên :
21/06/2014, 08:20
... standard of consumption was defined as the sum of its level of consumption plus its level of aspiration If the two components of the standard of consumption – the level of aspiration and the equipment ... realize the household’s conception of an appropriate standard of living.76 As the level of aspiration designates the gap between the actual and the desired level of consumption, a household’s standard ... cent of their respective incomes Savings of DM 2000 and more occur twice as often among the conscientious than among the carefree; almost half of the latter possess no savings at all.58 These and...
- 27
- 284
- 0
The Psychology of Money and Public Finance by Günter Schmölders (Dec 12, 2006)_6 ppt
Ngày tải lên :
21/06/2014, 08:20
... postulate of justice was also clearly in the minds of the representatives of the ‘romantic’ and later the ‘historical-ethical’ schools of economic theory whenever they proffered opinions on the ... corporation tax laws the decline of the Greek city-states, to the later demise of the Roman Empire and to the failure of Imperial power during the Middle Ages in Germany.36 The Netherlands breaking ... philosophy of the Middle Ages, it found its earlier high point with the awakening of the social conscience in the ‘victim theory of taxation, which raised the relationship between the citizen and the...
- 27
- 279
- 0
The Psychology of Money and Public Finance by Günter Schmölders (Dec 12, 2006)_7 pot
Ngày tải lên :
21/06/2014, 08:20
... privileges, the ‘equivalence’ of the tax burden with the sought-after quid pro quo of protection by the state for person and property, the liberation of the poor, and setting taxes on the basis of the ... unstructured and undefined ‘sense of justice’, but rather they are received teaching on public finance theory of the era concerned, but are simultaneously also and always an expression of the spirit of the ... level – the ‘higher’ level – one finds the justice of the rational mind, of conscience, and born of the knowledge of economic relationships – in other words, the notions of justice held by knowledgeable...
- 27
- 287
- 0
The Psychology of Money and Public Finance by Günter Schmölders (Dec 12, 2006)_8 pptx
Ngày tải lên :
21/06/2014, 08:20
... with the quantity theory of inflation While the latter explains the rise of the general price level merely in terms of the so-called volume of money, modified by the velocity of circulation, the ... caused) by deflationary processes really exist; on the other hand, the role of money in the ups and downs of business remained, for most of the writers, rather nebulous In the United States, the ... recalled by the proposition of the Radcliffe Report that the liquidity status of the business firm depends on the amount of money people think they can get hold of, whether by receipts of income...
- 27
- 262
- 0
The Psychology of Money and Public Finance by Günter Schmölders (Dec 12, 2006)_9 doc
Ngày tải lên :
21/06/2014, 08:20
... thresholds theory, 163 education, 145–6 and attitude to price and currency developments, 108 and consumption standard, 128 and ownership of consumer goods, 127 and the psychology of saving, 100, ... Volkswirtschaftliche Theorie der Liquidität [Economic Theory of Liquidity], Frankfurt 1948 14 E.V Morgan, The ownership of capital and monetary policy, The Three Banks, no 42 (1959) 15 Report of the Committee ... 37, 139 age and consumption level, 132 and consumption standard, 130 and income expectations, 68 and mental attitude, 67 and psychology of saving, 100 and saving, 24 and thrift, 60 and wishes,...
- 22
- 348
- 0