... included in the substrings created, which has the effect of removing the character(s). The logic is much simpler and less error-prone. The foreach loop in the second half of the program puts the ... to the end of the string: “cd,e” . (It’s the “+ 1” that skips the comma.) The Concat() function puts the two substrings back together to create “abcd,e” . Control passes back up to the top of ... RemoveSpecialChars() function // from RemoveWhiteSpace program // RemoveSpecialChars - remove every occurrence of the // specified characters from the string public static string RemoveSpecialChars(string...
Ngày tải lên: 04/10/2013, 21:20
Ngày tải lên: 15/03/2014, 21:20
Báo cáo khoa học: "The Creation of a Corpus of English Metalanguage" pptx
Ngày tải lên: 16/03/2014, 19:20
fixed broadband wireless system design the creation of global mobile communications
Ngày tải lên: 03/06/2014, 00:52
Tài liệu Control the Creation and Behavior of Classes Now that you have code that can prepare all of the pdf
... the CCustomer class "inherit" all of the code in the CCustomerData class. You've probably done the former before, so try the latter. 1. In the declaration of the CCustomer class, ... First, the CCustomer class needs access to the data adapter code you created in the previous section. You could paste all of the code you have written so far in the End Try If mdsCust.Customers.Rows.Count ... mCustomer.Address Me.txtCity.Text = mCustomer.City Me.txtCompanyName.Text = mCustomer.CompanyName Me.txtContactName.Text = mCustomer.ContactName Me.txtContactTitle.Text = mCustomer.ContactTitle...
Ngày tải lên: 24/12/2013, 06:17
Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx
... involves conversion of UDP-glucuronate to UMP in the lumen of the vesicles and exchange of the latter with cytosolic UDPGlcNAc. Once inside microsomes, the latter can, in turn, be exchanged with cytosolic ... Program, Belgian Science Policy; and the Fonds de la Recherche Scientifique Me ´ dicale. CLL is a fellow of the Fonds National de la Recherche Scientifique (FNRS). References 1 Smirnoff N (2001) l-Ascorbic acid ... result of a glucuronidation– deglucuronidation cycle, with a hypothetical acceptor present in the microsomal fraction. Against this is the finding that saccharo-1,4-lactone did not affect the for- mation...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc
... GTA AGC CCC CTC GAG TCG TTC AG-3¢ Reverse sad, cloning 55¢-CGT CAC GGT ATT CGA AGC C- 3¢ Forward mao, RT-PCR 65¢-CAC TGG CTA ATT CCA GTG C- 3¢ Reverse mao, RT-PCR 75¢-CAC TAG CGA AGA TGC CGT C- 3¢ ... RT-PCR 85¢-CCA ACG CAG AAA CTC GGC-3¢ Reverse sad, RT-PCR 95¢-CGG CAT TAT CGG TGA CAG C- 3¢ Forward mabO, RT-PCR 10 5¢-CGC GCA ACA CTG AGG GAC-3¢ Reverse mabO, RT-PCR c- N-methylaminobutyrate catabolism ... acid semialdehyde is then converted to succinate by the SsaDH encoded by the sad gene of pAO1 (see Fig. 2). Succinate may enter the citric acid cycle, thus comple- ting the catabolic pathway of CH 3 -4-aminobutyrate generated...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc
... 204 RT-PCR GAPDH GAG CTG AAC GGG AAG CTC ACT GG GTG AGG GAG ATG CTC AGT GTT GG 429 RT-PCR CaN AGTAACAATTTTCAGTGCTCCAAAC AATATACGGTTCATGGCAATACTGT 205 RT-PCR CaMKII CTACCCCGGCGCTGGAGTCAAC TCAGATGTTTTGCCACAAAGAGGTGCCTCCT ... TCAGATGTTTTGCCACAAAGAGGTGCCTCCT 530 RT-PCR COX I CGA GCT TGC TTT ACA TCA GCC TGT GTC ATC TAG GGT GAA GCC 317 Northern blot COX Vb GGC TTC AAG GTT ACT TCG CGG TGG GGC ACC AGC TTG TAA TGG 371 Northern ... differences in mitochondrial volume, the oxidative capacity of muscles is also affected by physiological conditions, such as chronic exercise or contraction activity. Increased oxidative capacity of...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt
... shown that the presence of the remainder of the acidic tail results in the thermodynamic stabilization of Hfq by 1.8 kcalÆmol )1 . A comparison of the average electron microscopy images of Hfq Nter and ... b4ofchainBandthe strand b5 of chain A in the crystal structure [19,20]. As the electron microscopy data pointed to a conformational change at the subunits’ interface upon truncation of Hfq, we measured the secondary ... shown) – occur Fig. 1. Multiple sequence alignment of various bacterial Hfqs. The alignment was produced with T-COFFEE. Amino acids characteristic of Hfq are indicated in black. Amino acids in...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc
... for investigation of the interaction between APC and FVa. However, given the general abundance of heparin-like structures on the surface of the vascular bed, and the lack of good estimates of local concentrations ... characterize the influence of heparin on the APC- catalyzed inactivation of FVa and to confirm the specificity of the effects observed in Fig. 1, time courses of FVa inactivation by wild-type APC were ... right: molecular surface of FVa domains A1, A2, and A3 color-coded according to electrostatic potentials. Preliminary docking of FVa Arg506 into the catalytic cleft of APC suggests that the 37 loop...
Ngày tải lên: 19/02/2014, 13:20
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... In the absence of differential regulation of a speci c nuclear gene coding for the subunits of CytOX, changes in the microenvironment of the cell may induce alterations in the catalytic efficiency ... that of genes CYC1 and CYC7, which encode iso-1 and iso-2 of yeast cytochrome c, respectively. CytOX 5a and CYC1 are coexpressed under aerobic conditions (O 2 >0.5l M ), whereas CytOX 5b and CYC7 ... efficiency of the enzyme (TN for cytochrome c oxidase) remained nearly the same. Increased glycolytic flux and alterations in the kinetic characteristics of the CytOX might be the two mechanisms by which...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... lLof100m M CaCl 2 at a rate of 0.3 mLÆmin )1 . The presence of calcium chloride was required in the collected fractions because the lectin was unstable in the presence of EDTA. The fractions were vortexed ... were detected. Thus, sialic acid-recognizing lectins would be of immense value in identifying and discriminating sialic acids on the surface of cancer cells. The sialic acid-speci c lectins are ... sugar chain of animal glycoconjugate. They act as an important component of the ligands recognized by the lectins. Recognition can be affected by speci c structural variations and modifications of...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx
... (1987) II-BGlc, a glucose receptor of the bacterial phosphotransferase system: molecular cloning of ptsG and purification of the receptor from an overproducing strain of Escherichia coli. Proc. Natl. Acad. Sci. ... above, the presence of Glc did not protect, but to the contrary sensitized, EII Glc for inactivation (Fig. 5A, grey bars). In the presence of Glc, the rates of EII Glc inactivation by 1a and 1c increased ... nonspeci c reagent with equal access to both Cys. Whatever the cause, sensitization by Glc cannot be the (trivial) effect of Glc-induced dephosphorylation/deprotection of Cys421, because EII Glc in...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... PKCa in VSMC. From these results, we concluded that the enhan- cing effect of LPS/IFN-induced NO production was caused by upregulation of PKC in VSMC. Keywords: a-tocopheryl hemisuccunate; a-tocopherol; ... Pharmaceutical Sciences, University of Tokushima, Japan The effect of a-tocopheryl hemisuccinate (TS) on lipo- polysaccharide (LPS)/interferon -c (IFN)-induced nitric oxide production in rat vascular ... [8–15,29], the inhibitory effect of TS on the cell growth at higher concentrations might prevent the increase in the enhancing effect of TS on LPS/IFN-induced NO production in VSMC. Therefore,...
Ngày tải lên: 22/02/2014, 04:20
Tài liệu Báo cáo Y học: Dissecting the effect of trifluoroethanol on ribonuclease A Subtle structural changes detected by nonspecific proteases ppt
... C) , circular dichroism and fluorescence spectroscopy indicate a cooperative col- lapse of the tertiary structure of RNase A coinciding with the loss of its enzymatic activity. In contrast to the ... in this range of trifluoroethanol concentration, no significant changes of the spectroscopic properties of the enzyme could be detected. Therefore, the decrease of the proteolytic susceptibility ... differences in the changes of the tertiary and secondary structures are reflected in the activity of RNase A, its activity towards cCMP was measured as a function of the concentration of trifluoroethanol...
Ngày tải lên: 22/02/2014, 07:20
The analysis of vitamin c
... parameter called the titer -the number of mg of ascorbic acid which reacts with 1 ml- of iodine solu tion. This number is easily found from the I 2 concentration and the mass relationship in the ... of the juice took 9.85 mL of the iodine solution to reach the starch end point. a. What is the concentration of vitamin C in the juice in mg vitamin C/ 100 mL of juice ( mg/ 100 mL) ? ... I 2 concentration begins to go up and the reaction with the indicator occurs: )()( 22 complexIstarchstarchaqI −⎯→⎯+ yellow blue Because an I 2 solution cannot be prepared accurately...
Ngày tải lên: 03/03/2014, 11:49
THE ANTHROPOLOGY OF ONLINE COMMUNITIES BY Samuel M.Wilson and Leighton C. Peterson doc
... The War of Desire and Tech- nology at the Close of the Mechanical Age. Cambridge, MA: MIT Thomas J. 1996. Introduction: a debate about the ethics of fair practices in collecting social science ... of communicative practices? Are new forms of communicative competence developing as a consequence of new media tools in of ine speech communities? How does technology enhance or displace discourses ... in communication and media studies, and often called computer-mediated communication (CMC) research. These scholars revealed changing communica- tive practices online, which were seen to be either...
Ngày tải lên: 06/03/2014, 21:20
Bạn có muốn tìm thêm với từ khóa: