the behaviour of t end plate connections to shs part ii a numerical model
Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx
Ngày tải lên :
17/03/2014, 03:20
... showed the same inhibition activity as that of the C albicans-derived pentaose, Manb1fi2Mana1fi 2Mana1fi2Mana1fi2Man The inhibition activity of LM5 was twice that of LM4, but was the same as that of the ... mannans from their 2D-HOHAHA spectra The object of this study was to determine the detailed chemical structure of the mannan of C lusitaniae, which is antigenically related to C albicans serotype ... b1fi2Mana1fi2Mana1fi2 a1 fi3Mana1fi2Mana1fi2Mana1fi2 ›6 Mana1 Mana1fi3 a1 fi6Mana1fi6Mana1fi6Mana1fi6 ›2 Mana1 a1 fi6Mana1fi6Mana1fi6Mana1fi6 > > ›2 ›2 ›2 > > = Mana1 a1 fi6Mana1fi6Mana1fi6Mana1fi6 > ›2 > > > a1 fi2Mana1 ; a1 fi6Mana1fi6Mana1fi6Mana1fi6...
- 11
- 456
- 0
Báo cáo hóa học: " The prevalence of polypharmacy in elderly attenders to an emergency department - a problem with a need for an effective solution" doc
Ngày tải lên :
21/06/2014, 03:20
... designed the study and the data collection proforma; TFC assisted with collation of the data; AB, DM, AAK and SE actively collected the data from the departmental records All the data have been verified ... drug combinations leading to potential adverse interaction with warfarin usage This may be because of the close level of monitoring of therapeutic anticoagulation in dedicated anticoagulation clinics ... polypharmacy with the presenting complaint, as data were collected retrospectively and also because for any given presentation there may be the coexistence of multiple factors contributing to the...
- 3
- 340
- 0
Báo cáo y học: "The significance of glucose, insulin and potassium for immunology and oncology: a new model of immunity" ppt
Ngày tải lên :
11/08/2014, 10:23
... Endogenous Mediator) also acts as a hormone, stimulating uptake of amino acids and increasing synthesis of acute phase reactants [32] Beutler et al., pointed out that the inflammatory cytokine, Tumor ... doses, duration of treatment and method of administration, but one of the advantages of GIK is that it is not a new drug Clinicians are familiar with the signs of toxicity and counter-measures The ... demonstrate the activity of intratumoral TGIK and the finding that the formulation is rendered ineffective by removal of insulin Consequently, this experiment demonstrates that the antitumor activity...
- 12
- 430
- 0
the behaviour of interest rates
Ngày tải lên :
05/01/2014, 16:56
... expected return relative to alternative assets The quantity demanded of an asset is negatively related to the risk of its returns relative to alternative assets The quantity demanded of an asset is ... relative to alternative assets Theory of Asset Demand The quantity demanded of an asset is positively related to wealth The quantity demanded of an asset is positively related to its expected ... alternative assets Risk - the degree of uncertainty associated with the return on one asset relative to alternative assets Liquidity - the ease and speed with which an asset can be turned into cash...
- 31
- 2.5K
- 1
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
Ngày tải lên :
14/02/2014, 22:20
... lines) To test the statistical robustness of the identified model parameters and to validate them with experimental data, 50 independent identification processes with varying initial carbohydrate levels ... both their absolute values and the time course From the simulations, it appears that the ability to sustain the cycling of sucrose, which has been postulated to function in the stabilization of ... photosynthesis and long-distance transport for acclimation The requirement for photosynthetic activity has also been demonstrated [21], and it was shown that acclimation does not take place in total darkness...
- 13
- 707
- 0
Tài liệu Determinants of Productivity for Military Personnel - A Review of Findings on the Contribution of Experience, Training, and Aptitude to Military Performance pdf
Ngày tải lên :
17/02/2014, 22:20
... relationships between AFQT and years of experience or additional training are linear Rather, the authors note that although the magnitude of the trade-off may vary, it is at least one -to- one and ... personnel and the team’s success at the assigned tasks The multivariate model allows the effect of AFQT on performance to be isolated from the effects of other variables, as though the other variables ... specifically, the model predicts that for active-duty units with an average AFQT at the midpoint of category IIIA, there is a 63 percent chance that the unit will successfully operate the system in the...
- 87
- 627
- 0
THE ELEMENTS OF DRAWING IN THREE LETTERS TO BEGINNERS doc
Ngày tải lên :
06/03/2014, 01:21
... time than another to attain the same results, and the results thus painfully attained are never quite so satisfactory as those got with greater ease when the faculties are naturally adapted to the ... drawing 35 patterns; and the greater they are, the more pains they take to it truly.[12] Nor can there be better practice at any time, as introductory to the nobler complication of natural detail For ... gradation is given to the sky by leaving the lines farther and farther apart; but you must make your lines as fine as you can, as well as far apart, towards the light; and not try to make them...
- 193
- 594
- 0
PHYSICS AND POLITICS OR THOUGHTS ON THE APPLICATION OF THE PRINCIPLES OF ''''NATURAL SELECTION'''' AND ''''INHERITANCE'''' TO POLITICAL SOCIETY pptx
Ngày tải lên :
06/03/2014, 13:20
... which tends to make the nation which has it superior to the nation which has it not; that many of these advantages can be imparted to subjugated races, or imitated by competing races; and that, though ... that improvement even in part took the military line, it might give the mixed and ameliorated state a steady advantage in the battle of nations, and a greater chance of lasting in the world Another ... learn his drill to put himself, for instance, into the attitude of 'attention' at the instant the word of command is heard But, after a time, the sound of the word gives rise to the act, whether...
- 143
- 597
- 0
NORDIC RADIOECOLOGY THE TRANSFER OF RADIONUCLIDES THROUGH NORDIC ECOSYSTEMS TO MAN potx
Ngày tải lên :
15/03/2014, 19:20
... characteristics This allows an evaluation of the precision of the model predictions and an assessment of the parameters contributing to their uncertainty The latter is particularly important in the ... and to compare the uptake in Fucus with the accumulation rates in other algae, - secure data for a relevant calculation of the dose to the Nordic population from the aquatic environment and to ... parameters contributing to their uncertainty The latter is particularly important in the long term when factors other than the primary load become important in determing radiocaesium concentrations...
- 501
- 1.2K
- 0
The Future Isn’t What It Used To Be Changing Trends And Their Implications For Transport Planning doc
Ngày tải lên :
23/03/2014, 10:20
... Future Isn t What It Used To Be: Changing Trends And Their Implications For Transport Planning Victoria Transport Policy Institute Factors Affecting Travel Demands Travel demand refers to the amount ... but started to decline in the 1990s 19 The Future Isn t What It Used To Be: Changing Trends And Their Implications For Transport Planning Victoria Transport Policy Institute Transportation Options ... predictions, even the most sophisticated and thoughtful, hit their mark.” He presents an example of Washington State Department of Transportation projections of traffic growth on State Route 520, a...
- 42
- 474
- 0
THE ATLAS OF ECONOMIC COMPLEXITY MAPPING PATHS TO PROSPERITY potx
Ngày tải lên :
23/03/2014, 19:20
... two additional terms: the ECI at the beginning of the decade and an interaction term between the ECI and the initial level of GDP per capita The interaction attempts to capture the idea that the ... to Adam Smith the idea that the division of labor is the secret of the wealth of nations In a modern reinterpretation of this idea, the division of labor is what allows us to access a quantity ... products that they already create to others that are “close by” in terms of the productive knowledge that they require The Atlas of Economic Complexity attempts to measure the amount of productive...
- 91
- 395
- 0
THE ATLAS OF ECONOMIC COMPLEXITY MAPPING PATHS TO PROSPERITY doc
Ngày tải lên :
23/03/2014, 20:20
... two additional terms: the ECI at the beginning of the decade and an interaction term between the ECI and the initial level of GDP per capita The interaction attempts to capture the idea that the ... to Adam Smith the idea that the division of labor is the secret of the wealth of nations In a modern reinterpretation of this idea, the division of labor is what allows us to access a quantity ... products that they already create to others that are “close by” in terms of the productive knowledge that they require The Atlas of Economic Complexity attempts to measure the amount of productive...
- 91
- 361
- 0
Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc
Ngày tải lên :
30/03/2014, 20:20
... CCAACCACTATATTACACCAATGATGGAGCTGAA 700 700 100 Forward Reverse Probe CAACAAAGTGGATATTAAAGACAGGAAAG TGGCAGAAATGTCATAGTACTGAAGATT AAGGCAAAATCTATTGTCTTCCACCGGAAGAA 300 700 200 Forward Reverse Probe CTGGATTTCCTTTGGGCGTT ... AAAGGAGATCAAGCCGCACAT GTTCATAGCCAGAGGGAAGACATC CTCCTCACACACCTCCAGCATCCAGTATG 300 500 100 Forward Reverse Probe TCTCCTCACTGGAGTTGATGCA AACGGAACCATCCATTTGACA CTCTATGTCGCACCACTGATAACCTGAGACCTT 300 ... Forward Reverse Probe CCGAAGAGGAGTGGAGGAGACT ATATGCGGTTCTGGCTCATGA CATGTAATGAACCCATCCTAGACTCTGTTGGACA 700 700 150 Forward Reverse Probe TGAGGAGGGACAAAACCTTGAA TCGGTCACTGCCAGCATTC CCAACCACTATATTACACCAATGATGGAGCTGAA...
- 13
- 338
- 0
Báo cáo khoa học: "Simulating the Behaviour of Older versus Younger Users when Interacting with Spoken Dialogue Systems" pdf
Ngày tải lên :
31/03/2014, 00:20
... different dialogue systems Participants were asked to schedule a health care appointment with each of the systems, yielding a total of dialogues per participant System utterances were generated using ... attempted to confirm the user’s response), speech acts that indicate user initiative (init), and speech acts that indicate social interaction with the system (social) We also computed the average ... dialogue acts and dialogue context information Using a unique mapping, we associate each dialogue act with a speech act, task pair, where the speech act is task independent and the task corresponds to...
- 4
- 276
- 0
Báo cáo khoa học: "Determining the placement of German verbs in English–to–German SMT" ppt
Ngày tải lên :
31/03/2014, 21:20
... baseline SMT system, the subject they is likely to be a part of a translation phrase with the correct German equivalent (they have said → sie haben gesagt) They is then used as a disambiguating ... to help select the correct translation Here, the baseline SMT system again has an advantage as the verbs are consecutive It is likely they will be found in the training data and extracted with ... inflected, it is hard to predict how said is going to be translated If the distance between the auxiliary habe and the hypothesized translation of said is large, the language model will not be able...
- 10
- 514
- 0
The History of Australian Exploration from 1788 to 1888 ppt
Ngày tải lên :
31/03/2014, 21:20
... descent to the coast is steep and abrupt Most of the northern rivers, too, take their rise in a plateau that is almost on a level with the great plain, but cut their way down to the sea through ... itself into the sea in Victorian waters; thence we come to the Latrobe and the many minor streams that flow into the ocean instead of into the great receiver the Murray The Glenelg and the Wannon ... All attempts to the north fruitless Return of Stuart Chapter X 15 Chapter X [to 1863] Stuart's last Expedition Frew's Pond Daly Waters Arrival at the Sea The flag at last hoisted on the northern...
- 301
- 470
- 0
Báo cáo y học: Identification of an element within the promoter of human selenoprotein P responsive to transforming growth factor-b ppt
Ngày tải lên :
31/03/2014, 23:20
... Electrophoretic mobility shift assays A putative SBE from the SeP promoter (nucleotides 21808 to 21778, 50 -ACAAAACCTTTCAGACACTGAGTTGTA GAA-30 ; SBE in bold) annealed to its complementary strand ... achieved using the 45-nucleotide primer 50 -GATAGGTACACAAAACCTTTTACATACTG AGTTGTAGAAAGAAGG-30 (exchanged nucleotides are in bold) and its complementary sequence Luciferase assays Cell lysis was performed ... binding of Smad proteins to two adjacent DNA elements in the plasminogen activator inhibitor-1 promoter mediates transforming growth factor beta-induced smad-dependent transcriptional activation...
- 6
- 361
- 1
The relationships of forest and watershed characteristics to soil water retention, storm, runoff, erosion, and wave attenuation in vietnam
Ngày tải lên :
03/04/2014, 12:22
... integrating a sample ground data set, TM images, and a slope map and showed that the geostatistical method performed significantly better than traditional stratification in terms of overall and spatially ... systems (GIS) These techniques facilitate the calculation of watershed factors and produce several maps at both watershed and regional scales Chapter THE EFFECTS OF FOREST DEGRADATION ON SOIL WATER ... pointed out that increasing forest cover has the potential to decrease water yield and baseflow rate The increases in runoff with clearing result from a rise in the groundwater table rather than...
- 18
- 534
- 0