the battle for childhood creation of a russian myth
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
Ngày tải lên: 05/09/2013, 16:11
Considering the Creation of a Domestic Intelligence Agency in the United States pot
... National Audit Office AQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic Maghreb] ASALA Armenian Secret Army for the Liberation of Armenia ASIO Australian Security Intelligence Organisation ASIS ... xv Abbreviations AAT Administrative Appeals Tribunal AD Action Directe [Direct Action] AFP Australian Federal Police AG Attorney-General AIC Australian intelligence community ANAO Australian National ... information on the activities of Imperial Japan in the Asia-Pacific. 8 is legislation specifically designates ASIO as Australia’s principal national agency responsible for countering espionage,...
Ngày tải lên: 15/03/2014, 21:20
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx
... oryzae (TAKA) a- amylase: an application of the simulated- annealing method. Acta Crystallog Sect B 47, 535–544. 21 Tonozuka T, Sakai H, Ohta T & Sakano Y (1994) A convenient enzymatic synthesis ... Shimura Y, Ibuka A, Sakai H, Matsuzawa H, Sakano Y & Ohta T (1995) Comparison of primary structures and substrate specificities of two pullulan-hydrolyzing a- amylases, TVA I and TVA II, from Thermoactinomyces ... T, Okada S, Takesada Y, Iizuka M, Minamiura N & Imanaka T (1992) Action of neopullu- lanase. Neopullulanase catalyzes both hydrolysis and transglycosylation at a- (1 fi 4)- and a- (1 fi 6)-gluco- sidic...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: "The Creation of a Corpus of English Metalanguage" pptx
... 0.74. Kappa between the primary annotator and a hypothetical “majority voter” of the three additional annotators was 0.90. These results were taken as moderate indication of the reliability of ... Table 5: Frequencies of each category in the subset labeled by additional annotators and the values of the Kappa statistic for binary relabelings. The low value for remapped OM was expected, ... mentioned language. 4) Wikipedia is freely available. Various language learning materials were also considered, but legal and technical obstacles made them unsuitable for creating a freely available...
Ngày tải lên: 16/03/2014, 19:20
A POSITION PAPER FROM THE CENTER FOR INQUIRY OFFICE OF PUBLIC POLICY doc
... children and adolescents including the following: The American Academy of Pediatrics, The American Foundation for AIDS Research, The American Medical Association, The American Psychological Association, ... Association, The American Public Health Association, The Institute of Medicine, The Society for Adolescent Medicine, The National Education Association and The American School Health Association. ... context of marriage is the expected standard of human sexual activity 5. Teaches that sexual activity outside of the context of marriage is likely to have harmful psychological and physical effects...
Ngày tải lên: 22/03/2014, 15:21
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... Gambeta. We amplified the cDNA for cB using forward primer 5Â-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3Â and reverse primer 5Â-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3Â, and digested this with restriction ... primer 5Â-ACTTATACTACTCATATGCTCAACCC CAAGATCATC-3Â and reverse primer 5Â-ACTTATAC TATC CTCGAGCCACTGCATGTCCCGG-3Â, to produce an amplicon lacking the N- and C-terminal extensions of the full-length ... laboratory. References 1 Kapoor D, Kumar V, Chandrayan SK, Ahmed S, Shar- ma S, Datt M, Singh B, Karthikeyan S & Guptasarma P (2008) Replacement of the active surface of a thermo- phile protein by that of a homologous...
Ngày tải lên: 23/03/2014, 04:21
lepler - the many panics of 1837; people, politics, and the creation of a transatlantic financial crisis (2013)
Ngày tải lên: 01/11/2014, 12:16
Tài liệu Controlling the Playback Speed and Direction of a Timeline docx
... that, the value of action is further evaluated. If action has a value of "ff", an onEnterFrame event handler is attached to the messages_mc instance. This event handler advances the ... represents the frame number at which the playhead currently resides. For example, if the main movie is being played, the following script places the numerical value of the playhead's current frame ... this timeline forward and backward. 3. Return to the main timeline. With the Actions panel open, select Frame 1 of the Actions layer and add the following script at the end of the current script:...
Ngày tải lên: 24/12/2013, 07:17
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx
... 5Â-gagagattt gctttgcgggttatggatctgc-3Â; mutation K20 1A, 5Â-gttatggatctgct accgcggctccgatcctaaacg-3Â; mutation K201F, 5Â-ggttatggatctg ctacttcgctccgatcctaaacgc-3Â; and mutation M45 3A, 5Â-ggacaa ctttgaatgggcggagggttatattgag-3Â. ... to the sense strand are listed, as follows: mutation E19 0A, 5Â-caacgagcctagagcgatttgctttgagg-3Â; mutation E190Q, 5Â-caa cgagcctagacagatttgctttgagg-3Â; mutation E19 4A, 5Â-gagagattt gctttgcgggttatggatctgc-3Â; ... be the pathway for the release of the aglycone in the glyco- sylation step and the entrance of the water molecule involved in the hydrolysis of the covalent intermediate [17]. Thus, the unusual...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Marketing Experience Goods on the Internet: The Case for ‘Strong’ Word of Mouth ppt
... include the performing arts, the plastic arts (painting and photography) and popular culture, rather than traditional packaged goods and durables. The emotional arousal generated by these consumptive ... the way to abuse of online recommendations by commercially interested parties. As we can see, it is by no means clear what the literature means by, and what the advantages and disadvantages ... effective and fuller operationalisation of the WOM mechanisms in the empirical setting. The twin conceptions of weak and strong WOM, and the tracing back of the various trust mechanisms to the levels...
Ngày tải lên: 18/02/2014, 22:20
Tài liệu THE SEARCH FOR OBJECTIVE MEASURES OF AESTHETIC JUDGMENT: THE CASE OF MEMORY TRACES docx
... With Art Education in Each Dimension and for Each Category Dimensions Category Difference strong-null trace tdfp Pleasant Beautiful Interesting Original RA AA RD AD RA AA RD AD RA AA RD AD RA AA RD AD .950 .352 .827 .807 .950 .589 .666 .364 .451 .436 .691 .211 –.047 .443 .163 .204 3.09 2.02 3.16 3.06 2.74 1.89 1.77 .98 1.43 1.46 1.76 .61 –.16 1.46 .04 .53 40 43 38 39 40 42 38 37 40 42 38 37 40 42 38 37 .004 .049 .003 .004 .009 .066 .084 .333 .159 .152 .087 .544 .872 .151 .652 .597 Note: ... in the MasterClips catalogue and of similar content. The distracter for each Abstract-Decorative target stimulus was an image per - taining to the same series in the MasterClips catalogue and of ... distracter for each Abstract-Artistic target stimulus was a picture of same painter and period. The distracter for each Representational-Decorative target stimulus was an image pertaining to the same...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx
... protein sequence. Angle, the calculated angle between the helix axis and the plane of a model membrane. ASA, accessible surface area. +, the peptide has an adequate mean surface accessibility ‡ ... 87–111. 13 Iwanaga S, Okada M, Isawa H, Morita A, Yuda M & Chinzei Y (2003) Identification and characterization of novel salivary thrombin inhibitors from the ixodidae tick, Haemaphysalis longicornis. ... guidelines. Statistical analysis Data are represented as means ± SD. The significance of the results was assessed using one-way ANOVA imple- mented in medcalc for Windows, v. 8.2.0.1 (MedCalc Soft- ware, Mariakerke,...
Ngày tải lên: 07/03/2014, 01:20
The Citizen-Soldier or, Memoirs of a Volunteer potx
... despair. 14. Every day we have the roar of artillery, the rattle of musketry, the prancing of impatient steeds, the marching and countermarching of battalions, the roll of the drum, the clash and ... friend. The apple-jack dilated most engagingly on the remarkable beauty of the evening, the pleasantness of the weather generally, and the delightfulness of Shelbyville. There was a piano in the ... more cheerful and brilliant. The day was warm and pleasant. The country before us was, in a military sense, unexplored, and every ear was open to catch the sound of the first gun. The conviction that a battle...
Ngày tải lên: 17/03/2014, 02:20
Novel technique for rapid detection of a-globin gene mutations and deletions pot
... of mutation carrier samples, as follows: 5 cases of aCSa/ aa, 4 cases of aQSa/aa, and 3 cases of aWSa/aa (Table I). These results were in accordance with those from the mPCR, RDB, and sequencing ... southern China and Southeast Asia. Fig 3. DHPLC profiles for the duplex PCR products of 7 DNA samples of known genotypes at 50 C. 1 5 SEA/ SEA; 2 5 SEA/aa;35 SEA/aCSa;45 aa/aa;5523.7/aa;6524.2/aa;75 aQSaa/ aa. ... aQSaa/ aa. The peak appeared at 5.1 6 0.1 min, which indicates aa, aCSa, or aQSa alleles, whereas a peak appeared at 1.0 6 0.1 min, which indicates the positive SEA allele. (Color version of...
Ngày tải lên: 23/03/2014, 22:20
Symptomatology of Gynecological Malignancies: Experiences in the Gynecology Out-Patient Clinic of a Tertiary Care Hospital in Kolkata, India pot
... Care Hospital in Kolkata, India Madhutandra Sarkar 1, 2* , Hiralal Konar 3 , DK Raut 4 Madhutandra Sarkar et al Asian Pacic Journal of Cancer Prevention, Vol 11, 2010 788 malignancy, which ... gestational trophoblastic neoplasia in 5.3% of the patients each. However, vulval malignancy and vaginal malignancy had the least contribution (1.8% of the patients each). The nearly similar observations ... literate. Median value of the per capita monthly income of family of the patients was Rs. 400 and mean value was Rs. 543 with range of Rs. 100-2,500. The mean per capita monthly income of family...
Ngày tải lên: 28/03/2014, 14:20
PERIPHERAL NEUROPATHY - A NEW INSIGHT INTO THE MECHANISM, EVALUATION AND MANAGEMENT OF A COMPLEX DISORDER doc
... mechanical hyperalgesia, thermal hyperalgesia/hypoalgesia, mechanical/tactile allodynia thermal hyperalgesia thermal hyperalgesia/ hypoalgesia, tactile allodynia thermal/ mechanical ... Neuralgia and Recent Pharmacotherapies 147 Yuko Kanbayashi and Toyoshi Hosokawa of DPN, growth factor therapy early in disease progression may minimize the damage and aid the axonal repair. ... the role of Postural bal‐ ance in the evaluation of peripheral neuropathy. In the last chapter of section two, Dr Kan‐ bayashi and Dr Hosokawa reviewed the most recent advances in the pharmacotherapy...
Ngày tải lên: 30/03/2014, 23:20
Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx
... underlining and mutagenic changes are shown in bold). BPL -for, 5Â-TTCTTAA CCATGG GCTTCAAAAACCTGAT-CTGG-3Â;BPL-rev,5Â-TTAA GGATCCTAAGAACGAGACAGGCTGAACTCTCC-3Â; BCCPD67, 5Â-GTAA CCATGGGTGAACAGGAAGA A- 3Â;BCCP-rev,5Â- GGATCCTTAAACGTTTGTGTC TATAAG-3Â; ... spectra combined and the molecular mass determined by the MAXENT AND TRANSFORM algorithms of the MASS LYNX software (MicroMass). Assay of A. aeolicus BPL BPL activity was assayed by measuring the ... 5Â-GTAA CCATGGGTGAACAGGAAGA A- 3Â;BCCP-rev,5Â- GGATCCTTAAACGTTTGTGTC TATAAG-3Â; BCCP K117L, 5Â-GAAGCTCTACTG GTTATGAAC-3Â. DNA was isolated from agarose using a QIAquickề Gel Extraction Kit, and plasmid DNA was purified using a QIAprepÒ...
Ngày tải lên: 31/03/2014, 07:20