the angle sum of a triangle equals two right angles proof
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
Ngày tải lên :
19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...
- 8
- 494
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
Ngày tải lên :
14/03/2014, 13:20
... studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are ... Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two- mode random microlaser, the variation of laser parameters influences clearly on the transformation ... reveals that the increase of one mode photon density caused in the decrease of the other one Fig 1a Gain coefficient α1 varies Fig 1b Gain coefficient α2 varies D.V Hoang, M.H Hanh / VNU Journal...
- 4
- 343
- 0
Đề tài " The two possible values of the chromatic number of a random graph " pot
Ngày tải lên :
29/03/2014, 07:20
... This lemma is a variant of the classical Laplace method of asymptotic analysis in the case of the Birkhoff polytope Bk , i.e., the set of all k × k doubly stochastic matrices For a matrix A ∈ Bk ... Annals of Mathematics, 162 (2005), 1335–1351 The two possible values of the chromatic number of a random graph By Dimitris Achlioptas and Assaf Naor* Abstract Given d ∈ (0, ∞) let kd be the ... expected value of χ(G(n, p)) was known up to a factor of two for the case of fixed p, due to the work of Bollob´s and Erd˝s [6] and Grimmett a o and McDiarmid [10] This gap remained in place for another...
- 18
- 510
- 0
Báo cáo toán học: "RHOMBUS TILINGS OF A HEXAGON WITH TWO TRIANGLES MISSING ON THE SYMMETRY AXIS" pdf
Ngày tải lên :
07/08/2014, 06:20
... the latter constituting the most difficult part of the proof An outline of the proof is given in the next section The details are filled in in the subsequent sections Outline of the proofs of Theorems ... numbers of perfect matchings of G+ and G− We use again the correspondence between the rhombus tilings of a region of triangles and the perfect matchings of the dual graph and reduce the problem ... be a planar bipartite graph with reflective symmetry, which splits into two parts after removal of the vertices of the symmetry axis We can clearly assume that the symmetry axis is the x-axis Label...
- 19
- 303
- 0
Báo cáo toán học: "The subword complexity of a two-parameter family of sequences" pps
Ngày tải lên :
07/08/2014, 06:23
... this paper we investigate an additional property of the class of heap games for general s, t ∈ >0: the subword complexity of the characteristic function of A For fixed s, t ∈ >0, define the characteristic ... Every binary pattern of length six is avoidable on the two- letter alphabet, Acta Inform 29 (1992) 95–107 [15] W .A Wythoff, A modification of the game of Nim, Nieuw Arch Wiskunde (1907) 199–202 the electronic ... A has a similar property when s ≥ Perhaps associated with some of the A sequences for s ≥ is an integer m ≥ such that for all i, j, k, |(Ak+i −Ak )−(Aj+i −Aj )| ≤ m Another related observation...
- 19
- 293
- 0
Báo cáo toán học: "The number of 0-1-2 increasing trees as two different evaluations of the Tutte polynomial of a complete graph" potx
Ngày tải lên :
07/08/2014, 15:22
... tan(t) + sec(t) n! The result is originally from [1] but a proof may also be found in [7] The fact that the value Jn+1 (−1) equals an is mentioned in [6] but a proof of this together with other ... is an increasing tree where all the vertices have at most edges going out A remarkable result stated in [4] and proved in [5] (see also a bijective proof in [3]) is that an equals the number of ... functions and the Tutte polynomial Preprint [10] Stanley, R P.: Hyperplane arrangements, parking functions and tree inversions In: Sagan, B and Stanley, R (eds) Mathematical Essays in Honor of Gian-Carlo...
- 5
- 319
- 0
OPTIMIZING OVER THE EFFICIENT SET OF A CONVEX MULTIPLE OBJECTIVE PROBLEM TWO SPECIAL CASES1
Ngày tải lên :
23/04/2015, 10:02
... explicitly as the form of a standard mathematical programming problems, even in the case of linear multiple objective programming problem when the component functions f1 , , f k of f are linear and ... is an optimal solution of the problem (OP ) * Then x is an optimal solution of problem (OP0 ) Proof It is well known that a convex programming problem with the linear objective function has an ... find the optimal solution ( x* , y* ) Then x* is an optimal solution to problem (OP0 ) and h( x* ) is the optimal value of (OP0 ) The computational results are shown in Table Example Consider the...
- 10
- 182
- 0
The Marketing Strategy of a multinational join stock company.doc
Ngày tải lên :
27/10/2012, 16:51
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... (American) and Sanyo (Japanese) These are famous brands in the world market and Vietnamese consumers highly appreciate them A multinational join stock company has never had any complaint about the product ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...
- 25
- 623
- 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
- 6
- 428
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
Ngày tải lên :
19/02/2014, 19:20
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... glutamine to the active site location of the iron enzyme (Fe [A1 41Q]) has a very similar effect to removal of the existing glutamine and SOD activities are reasonably similar between the two mutants...
- 12
- 740
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
Ngày tải lên :
08/03/2014, 02:21
... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... state sin di(i) ¯(i) rectly to state sout , Astay,stay is the sum of all the internal transition probabilities within ¯(i) state Si , and Astay,out is the sum of all exit state probabilities The ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
Ngày tải lên :
08/03/2014, 09:20
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
Ngày tải lên :
08/03/2014, 22:20
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...
- 9
- 533
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
Ngày tải lên :
08/03/2014, 22:20
... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...
- 8
- 551
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
Ngày tải lên :
14/03/2014, 22:20
... S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... also that F −1 (An ) ∩ U0 = An ∪ Qn 0 A n ∩ An An An Figure Schematic picture of the annulus An and the “rectangle” An (viii) Finally, pull these annuli and rectangles back to define the sets ... (i) are immediate consequences of real a priori bounds (Theorem 2.5) and the fact that f has a cubic critical point at (compare the proof of Theorem 2.2(1) in [P2] as well as the following proof...
- 53
- 383
- 0
Đề tài " The diameter of the isomorphism class of a Banach space " pdf
Ngày tải lên :
15/03/2014, 09:20
... Tzafriri, Classical Banach Spaces I Sequence Spaces, -index of a Banach space, Israel J Springer-Verlag New York (1977) [Mc] R A McGuigan, Jr., Near isometry of Banach spaces and the Banach-Mazur ... lemma follows from Lemma and the the classical fact that every separable Banach space 1-embeds into C[0, 1] Lemma is false for some nonseparable spaces Partington [P] and Talagrand [T] proved that ... Annals of Mathematics, 162 (2005), 423–437 The diameter of the isomorphism class of a Banach space By W B Johnson and E Odell* Dedicated to the memory of V I Gurarii Abstract We prove that...
- 16
- 376
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
Ngày tải lên :
16/03/2014, 00:20
... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of ... represents the first example of the effects of an antimicrobial peptide from frog skin on the proteome of bacteria, and demonstrates that the bacterial membranes are the major targets of its mechanism of...
- 18
- 494
- 0