the absence of a rational process
Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx
Ngày tải lên :
18/06/2014, 18:20
... ELISA-assay remained negative throughout follow-up in of the seven cases (Table 1) We also investigated reactivity against single HCV proteins by the INNO-LIA HCV III assay A faint band against the ... hepatitis with about ten times elevated ALT levels A robust response against HCVhelicase was found in the proliferation assay at baseline and after clearance of HCV-RNA (SI values of 4.1 and 3.6, respectively) ... (22%) of the ELISPOT-assays and (16%) of the proliferation assays (table 6) In cases (37%) any of the two CD4 assays yielded at least one positive result Comparing these results with ELISPOT assays...
- 11
- 528
- 0
Báo cáo hóa học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" potx
Ngày tải lên :
20/06/2014, 01:20
... ELISA-assay remained negative throughout follow-up in of the seven cases (Table 1) We also investigated reactivity against single HCV proteins by the INNO-LIA HCV III assay A faint band against the ... hepatitis with about ten times elevated ALT levels A robust response against HCVhelicase was found in the proliferation assay at baseline and after clearance of HCV-RNA (SI values of 4.1 and 3.6, respectively) ... (22%) of the ELISPOT-assays and (16%) of the proliferation assays (table 6) In cases (37%) any of the two CD4 assays yielded at least one positive result Comparing these results with ELISPOT assays...
- 11
- 440
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
Ngày tải lên :
23/03/2014, 05:22
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... simultaneously with antitubulin (DM 1A) and anti-actin (lanes and 2) Other samples were stained with antineurofilament protein (lanes and 4) The volume of each sample was adjusted to load a similar amount...
- 14
- 416
- 0
Báo cáo khoa học: "A Note on the Implementation of Hierarchical Dirichlet Processes" docx
Ngày tải lên :
31/03/2014, 00:20
... representation for the state of the restaurant that doesn’t require explicit table tracking.6 Instead we maintain a histogram for each dish wi of the frequency of a table having a particular number of ... 2006 Hierarchical Dirichlet processes Journal of the American Statistical Association, 101(476):1566–1581 A C++ template class that implements the algorithm presented is made available at: http://homepages.inf.ed.ac.uk/tcohn/ ... Proc of the 45th Annual Meeting of the ACL (ACL-2007), Prague, Czech Republic Algorithms and describe the two operations required to maintain the state of a CRP.7 When a customer enters the restaurant...
- 4
- 379
- 0
a literature survey of active machine learning in the context of natural language processing
Ngày tải lên :
02/06/2014, 09:22
... size, Accn (L) is the maximal achievable accuracy when using algorithm L and all available training data, Acct (A) is the average accuracy achieved by active learning algorithm A and t amount of ... to a small set of labeled data, as well as a large set of unlabeled data Co-testing proceeds by first learning a hypothesis using each view of the data, then asking a human annotator to label the ... training data, and Acct (L) is the average accuracy achieved using random sampling and learning algorithm L and t amount of training data The deficiency measure captures the global performance of...
- 59
- 692
- 0
Báo cáo hóa học: " A predominance of R5-like HIV genotypes in vaginal secretions is associated with elevated plasma HIV-1 RNA levels and the absence of anti-retroviral therapy" docx
Ngày tải lên :
20/06/2014, 01:20
... sample preparation, carried out data analysis, and drafted the manuscript PK participated in the study design and conducted the statistical analyses RC participated in the design and coordination ... coordination of the study and facilitated the collection of clinical samples NL processed clinical samples and conducted PCR and viral load analyses AA participated in the coordination of the study, ... tract and plasma of women: compartmentalization of viral sequences, coreceptor usage, and glycosylation Proc Natl Acad Sci U S A 2003, 100(22):12972-12977 Sullivan ST, Mandava U, Evans-Strickfaden...
- 4
- 481
- 0
Báo cáo hóa học: " Research Article Dynamics of a Rational System of Difference Equations in the Plane" pot
Ngày tải lên :
21/06/2014, 05:20
... division of xn by the instance, one has that a0 n characteristic polynomial of A Further, by elementary techniques of linear algebra one can also compute them in terms of the eigenvalues of A an approach ... Consider an eigenvalue λ of A, and let λ2 , λ3 be the other nonnecessarily different eigenvalues of A Let us show that the eigenvalues of the Jacobian matrix at a fixed point associated to λ are just ... system and the description of the Advances in Difference Equations dynamics in the general case β2 / We finish the paper by describing the dynamics in the particular case where the coefficients and the...
- 17
- 365
- 0
Báo cáo hóa học: "Research Article The Solvability of a Class of General Nonlinear Implicit Variational Inequalities Based on Perturbed Three-Step Iterative Processes with Errors" potx
Ngày tải lên :
21/06/2014, 22:20
... Siddiqi and Q H Ansari, “Strongly nonlinear quasivariational inequalities,” Journal of Mathematical Analysis and Applications, vol 149, no 2, pp 444–450, 1990 22 A H Siddiqi and Q H Ansari, “General ... nonlinear variational inequalities,” Journal of Mathematical Analysis and Applications, vol 166, no 2, pp 386–392, 1992 23 L U Uko, “Strongly nonlinear generalized equations,” Journal of Mathematical ... S Adly, “Perturbed algorithms and sensitivity analysis for a general class of variational inclusions,” Journal of Mathematical Analysis and Applications, vol 201, no 2, pp 609–630, 1996 C Baiocchi...
- 13
- 251
- 0
Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc
Ngày tải lên :
09/08/2014, 06:22
... with some avascular areas, mild disorganization of the capillary architecture and absent or some ramified capillaries Finally, the late pattern criteria were irregular enlargement of capillaries, ... few or absent giant capillaries, absence of hemorrhages, severe loss of capillaries with large avascular areas, severe disorganization of the normal capillary distribution and frequent ramified/ ... is the inhibition of angiostatic factors rather than a further increase of VEGF Angiostatic factors are often cleaved enzymatically from extracellular matrix proteins [40] Among these extracellular...
- 10
- 432
- 0
Báo cáo y học: "Candida albicans genome sequence: a platform for genomics in the absence of genetics" potx
Ngày tải lên :
09/08/2014, 20:20
... such as C albicans (and from other related fungi)? C albicans has rarely been isolated in nature away from an animal host and has probably co-evolved along with humans for millions of years It ... Margarita SilvaHutner at the Department of Dermatology, Columbia College of Physicians and Surgeons (New York, USA) The original isolate number was 1775 and the strain is identical with strain ... decomposing leaf litter, whereas C albicans appears to have an obligate association with mammalian hosts Hence, comparative analyses of the genome sequences of these fungi is likely to provide important...
- 3
- 400
- 0
Báo cáo y học: "Absence of a serum melatonin rhythm under acutely extended darkness in the horse" ppsx
Ngày tải lên :
10/08/2014, 09:20
... re-entrainment rates of plasma melatonin and core body temperature following an abrupt 6-h phase advance of the LD cycle [23] In contrast to studies that demonstrate a gradual adaptation of melatonin ... data analysis and interpretation, and prepared the manuscript JAE contributed to study design, data analysis, interpretation and figure preparation, ran the MT RIA, and helped prepare the manuscript ... rise of melatonin arylalkylamine N-acetyltransferase (AA-NAT) in sheep is not accompanied by a similar rise in AANAT mRNA expression [39], such that the biosynthesis of MT is primarily gated...
- 8
- 325
- 0
báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx
Ngày tải lên :
11/08/2014, 23:22
... As in many other studies reported, rat was also used as a model in this study [1,6,8-10] The advantages include easy manipulation, maintenance and adaptation to the objectives of the study Other ... impaired, but on the contrary was stimulated, which may explain the absence of cartilage formation during the healing process The results of the present experimental work indicate that further ... direction maintained continuity and shape of the remaining cortical levels Trabecular proliferation was also apparent in a centripetal direction relative to the surgical cavity Medullary spaces showed...
- 9
- 361
- 0
Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc
Ngày tải lên :
13/08/2014, 16:20
... organizational properties may be the same The polyfunctional nature of RNA has already been alluded to; similarly, DNA, in what has Page of 29 D’Onofrio and An Theoretical Biology and Medical ... read from the node and contained in a buffer (mRNA) After post editing of the pre mRNA, the addition of a 5’ cap and poly (A) tail to the mRNA now allows this data package to become part of a ... servo head As the disk rotates, a new bit (flux boundary) travels across the receiving boundary area of the servo head and the data are read In the DHD, the DNA can be considered to remain relatively...
- 29
- 420
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
Ngày tải lên :
12/09/2012, 15:05
... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... object data It is usually made in response to a pager_data_request call made to the data manager by the kernel Typical data managers will only provide data upon demand (when processing pager_data_request...
- 23
- 1.3K
- 1
List the components of a radio system
Ngày tải lên :
13/09/2012, 10:52
... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...
- 30
- 920
- 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf
Ngày tải lên :
21/09/2012, 10:39
... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...
- 386
- 1.2K
- 4
Guest the meaning of a word
Ngày tải lên :
02/10/2012, 12:07
... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...
- 2
- 871
- 1
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
Ngày tải lên :
25/10/2012, 11:00
... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... finding has revealed that restricted antimicrobials has been started to be utilized more rationale after the initiation of NARP Also carbapenem 342 resistance rates of Pseudomonas spp and Acinetobacter...
- 6
- 692
- 0