the 15 million student — a message from one of my top students
How to Sell - Some tips from one of the most accomplished advertisers
Ngày tải lên :
18/06/2014, 15:05
... invaluable - David Ogilvy Advice from other great sales people SALESMANSHIP Across the board, great sales people say the ability to sell is a “mentality.” SALES GOOD SALESMANSHIP BAD SALESMANSHIP ... David Ogilvy wasn’t just one of the most accomplished advertisers of all time He was, at heart, the consummate salesman “ I started as a salesman, a door to door salesman for kitchen ... Greatest Salesperson? Enter to win and earn a part-time fellowship at OgilvyOne The top finalists are flown to Cannes, France, for the final competition at the Cannes Lions International Advertising...
- 26
- 347
- 0
báo cáo hóa học: " Factor structure and internal consistency of the 12-item General Health Questionnaire (GHQ-12) and the Subjective Vitality Scale (VS), and the relationship between them: a study from France" potx
Ngày tải lên :
18/06/2014, 19:20
... generalized to the whole elderly population of France MSY was the main investigator and analysed the data and wrote the first draft AI and CR contributed to the study design and the analysis AM ... Questionnaire (GHQ-12): translation and validation study of the Iranian version Health Qual Life Outcomes 2003, 1:66 Campbell A, Knowles S: A confirmatory factor analysis of the GHQ12 using a large Australian ... between the different translations and the final versions were made available for this study Data were then collected from a sample of elderly French adults who practised physical activities regularly...
- 6
- 526
- 0
the passive in english a perspective from cognitive semantics (with reference to vietnamese) = dạng bị động trong tiếng anh dưới góc độ ngữ nghĩa học tri nhận (có liên hệ tiếng việt
Ngày tải lên :
02/03/2015, 14:17
... 1995: 154 ) He argues that there are a large number of parallels between visual perception and mental conceptualization, and that these parallels are identifiable in language One of the major tenets ... of passives if grammatical relations are not mentioned They propose a universal characterization which depends on grammatical relations They assume that a clause consists of a network of grammatical ... profound and thoughtful meaning of the title of the dissertation Aims of the study The study aims to provide a critical analysis of three major theoretical approaches of explaining language phenomena...
- 180
- 697
- 3
The passive in English a perspective from cognitive semantics (with reference to Vietnamese)
Ngày tải lên :
10/08/2015, 19:52
... to the title, hoping to create a profound and thoughtful meaning of the title of the dissertation Aims of the study The study aims to provide a critical analysis of three major theoretical approaches ... obliquely via a by-phrase, and that the object in (a) serves as the subject/patient in (b.) Traditional grammar treats passive voice as the change of the morphology in verbs, with the inversion of the ... learners to take a standpoint in analyzing languages In particular, a thorough understanding and fully developed arguments for the explanation of the structure are crucial A note should be taken...
- 21
- 528
- 3
27023 a message from an alien
Ngày tải lên :
27/08/2016, 21:27
... Now, write the same about you What are you doing… At the moment _ Today ... c This d e f a b c d e f week _ _ This month _ This year ... This month _ This year _ In your life ...
- 2
- 238
- 0
Blackwell Publishing Ltd Gregariousness and protandry promote reproductive insurance in the invasive gastropod Crepidula fornicata: evidence from assignment of larval paternity potx
Ngày tải lên :
22/03/2014, 12:20
... same way, ‘male fathers’ (i.e fathers that were males at time of sampling) are, on average, significantly taller than ‘male nonfathers’ (i.e males of the maternal stack that were not fathers; ... males than small males in the Rozegat population Analysis of variance showed that fathers are, on average, significantly taller than nonfathers within a stack (d.f = 1, Fig Percentage of larvae, ... change: a study of the mollusca Malacologia, 17, 365–391 Hoagland KE (1986) Patterns of encapsulation and brooding in the Calyptraeidae (Prosobranchia: Mesogastropoda) American Malacological...
- 13
- 337
- 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx
Ngày tải lên :
31/03/2014, 09:20
... transferase Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase IGb3 synthetase IGb3 synthetase Forssman synthetasea Forssman synthetase Human Rat Pig Mouse Human ... for 15 at room temperature Amplification of the cDNA corresponding to the A enzyme cDNA was performed with the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA Amplification ... the urinary bladder, the uterus and the thymus A weaker signal was obtained from the pancreas and very weak, barely detectable, signals were visible from a salivary gland, muscle and spleen The...
- 8
- 499
- 0
Báo cáo hóa học: " The Reflux Disease Questionnaire: a measure for assessment of treatment response in clinical trials" pdf
Ngày tải lên :
18/06/2014, 22:20
... of the translated RDQ High levels of internal consistency across the translated RDQ scales would be evidence of the amenability to translation Analysis revealed that, regardless of language, all ... investigating its responsiveness to changed symptom status as a result of therapy in a large clinical population of patients diagnosed as having GERD The concordance between the RDQ evaluations of ... structured by the trial case record form for each visit and graded = none, = mild, = moderate, and = severe Translation and cultural adaptation The RDQ was translated into Norwegian and Swedish according...
- 6
- 462
- 0
Báo cáo y học: "Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation" pps
Ngày tải lên :
11/08/2014, 08:22
... site of infection and these cells release proteases and other agents that cause structural damage to the airways Anti-inflammatory agents are used to manage lung inflammation in CF, but have adverse ... Withaferin A (WFA), a steroidal lactone isolated from the herb Withania somnifera (also known as Indian Ginseng and Ashwagandha), which is widely used in traditional Indian medicine as an antiinflammatory ... concentrations of WFA followed by stimulation with 10% PAF (WFA, 0.3, and μM) Data from luciferase reporter assays are reported as averaged arbitrary mean luminescence + standard deviation from samples...
- 5
- 306
- 0
Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot
Ngày tải lên :
11/08/2014, 15:22
... sample using an internationally validated instrument, based on a conceptual framework, and we analyzed our data in such a way as to make QOL data clinically relevant as a population health measure ... for the Advancement of Arab Children (KSAAC) Thereafter, the Principal of each selected school was approached for approval and for the cooperation of the school’s psychologists At the preliminary ... by analysis of covariance (ANCOVA) We used multiple regression analyses to assess the associations of QOL in the multivariate context, with scores on the general facet and each of the domains as...
- 12
- 500
- 0
Báo cáo y học: "Do electronic health records affect the patient-psychiatrist relationship? A before & after study of psychiatric outpatients" doc
Ngày tải lên :
11/08/2014, 17:20
... subjects, and for subjects stratified by their primary diagnosis, none of the changes reached statistical significance A post-hoc analysis of average responses for each question separately (rather than ... of the UNM General Clinical Research Center Scholars’ Program RB is a Professor of Psychiatry and the Associate Dean for Clinical Affairs of the UNM School of Medicine PJK is an Assistant Professor ... efficiency, and patient views [24] This study is the first we are aware of that attempted to assess the impact of EHR use on the quality of the patient-psychiatrist relationship in a behavioral health...
- 9
- 372
- 0
Báo cáo y học: "Risk assessment in the first fifteen minutes: a prospective cohort study of a simple physiological scoring system in the emergency department" ppsx
Ngày tải lên :
14/08/2014, 07:21
... Pittard AJ: Out of our reach? Assessing the impact of introducing a critical care outreach service Anaesthesia 2003, 58:882-885 19 DeVita MA, Braithwaite RS, Mahidhara R, Stuart S, Foraida M, ... LMe, LMa and JT participated in the design of the study DB designed the study database RE, DB, LMe and LMa collected all data on ED patients TM and DB performed the statistical analysis The manuscript ... this has not biased the main results of the study All the data needed for the VSS were collected by the same staff as part of their routine clinical work In cases where the data were not duplicated...
- 9
- 416
- 0
DEPRESSIVE SYMPTOMS AND RELATED FACTORS OF THE GENERAL MEDICAL STUDENT AT HAI PHONG UNIVERSITY OF MEDICINE AND PHARMACY IN 2016
Ngày tải lên :
09/06/2016, 22:40
... Qualitative (Binary) Qualitative (Binary) Qualitative (Binary) Qualitative (Binary) Qualitative (Binary) Qualitative (Binary) Qualitative (Binary) Qualitative (Binary) Qualitative (Binary) Qualitative ... participants The list of all the general medical students was taken from the Undergraduate Training Department Total 2839 students including classes of 1st grade, classes of 2nd grade, classes of ... index measurement Table 2.2: Variables and index measurement Variable Variables Classification 19 groups General characteristics: The characteristics of the general medical students at Hai Phong...
- 78
- 403
- 0
An investigation into the relationship between motivations and language learning strategies of first year students at faculty of electrical engineering technology, hanoi university of industry
Ngày tải lên :
19/07/2017, 19:26
... motivation was adapted from one of the three scales in the questionnaire of Schmidt & Watanabe (2001) that was used to investigate the relationship among motivation, strategy use and pedagogical ... motivation The average of each strategy in the six categories was calculated to find out frequency of using strategies Then the averages of all the strategies in each category were 22 averaged, ... parts The first part (part A) collects the information about language learning motivation The second part (part B) collects the data with regard to language learning strategy use A questionnaire...
- 77
- 379
- 2
A History of Writing one of the earliest examples of writing, a 4th millennium tablet from Uruk, lists sacks of grain and heads of cattle ppt
Ngày tải lên :
02/04/2014, 05:20
... information, read, the great god, foremost of the west, that he may give a good burial to the god’s father of Amun-Re, king of gods, Pawiaenadja, true of voice The arrow points to an apparent ... to free Korea of the influence of Chinese writing The earliest Japanese writing, dating from the 8th c., and perhaps as early as the 6th c., is called manyogana and uses Chinese characters (right ... the 10th or 11th c The sole copy was damaged in a fire in the late 18th c The futharc is a runic system used in Anglo-Saxon England and parts of Europe, mainly for inscriptions The Franks Casket,...
- 32
- 505
- 0
Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf
Ngày tải lên :
20/06/2014, 01:20
... cultured samples) NA8F-M13 5'-GTA AAA CGA CGG CCA GT GRA CHC ARG ART CIK MRTG-3'- and NA10R-M13 5'-CAG GAA ACA GCT ATG AC CCI IKC CAR TTR TCY CTR CA-3' or NA8F 5'-GRA CHC ARG ART CIK MRTG-3' and NA10R ... representation of 3,337 available sequences in the NCBI database at the time the study was conducted All NA subtypes were aligned against the NA10R primer and analyzed for discrepancies at the 3'end The ... samples from allantoic from all NA One- step RT-PCR amplification of NA gene from all NA subtypes using animal samples from allantoic fluids A fragment of approximately 253 bp was amplified using...
- 11
- 378
- 0
A Call from the Dark
Ngày tải lên :
06/11/2012, 16:13
... showers, washing my blonde hair slowly and rhythmically, just letting the steam clear my head and the soap wash all over me It’s probably the most peaceful part of the day Then, standing at the kitchen ... straining at their leashes or running maniacally after tennis balls Dogs are always so happy Every time I see a dog I wonder why I don’t have one In fact we don’t have any pets at all They’ve all ... released on DVD yet Some, including one with Tom Hanks and another with Charlize Theron, weren’t even in the cinemas in Australia as far as I knew! A list of labels with addresses lay on top of...
- 11
- 470
- 0
Potential biogas production from sewage sludge: A case study of the sewage treatment plant at Kwame Nkrumah university of science and technology, Ghana
Ngày tải lên :
05/09/2013, 16:11
... Figure Layout of KNUST sewage treatment plant Methodology Sample of the sewage from the PST was collected and analysed to determine the quality of the sewage The main component of interest was the ... on vacation indicating low population hence the variation in the monthly sludge generation The estimation of the biogas potential of the sludge the quality of the sludge was analysed and the ... 2007 [7] Barelli D., Csambalik L., Mestas C and Santos D Economical and Environmental Analysis of a Biogas Plant within the Context of a Real Farm The Royal Veterinary and Agricultural University,...
- 8
- 879
- 1
Computer illiteracy as one of the main problem of business student
Ngày tải lên :
26/10/2013, 17:15
... first alternative of solving the problem, what can we suggest? We have another alternative, which is called “Simplification of access to computer classes.” We mean the organization of computer classes ... for them, instead of learning how to it themselves The third cause is lack of access to computer The fourth cause is dissatisfactory school base The fifth cause is insufficient allocation of application ... classes in our university which often aren’t used by students And there are students who have skills in this sphere And they may agree to work as a consultation in these classes, but without salaries...
- 4
- 351
- 0