testing the statistical significance of a cross tabulation table
Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx
Ngày tải lên :
20/02/2014, 18:20
... The values inside brackets are the rate of decrease 4.3 More Applicable for a Result Having a Few Errors In EPC+SSC, the rate of decrease was 8.5%, and the decrease was obtained in all type of ... semantic distance calculation, and its application to speech translation ACI.JF_.ACLWorkshop Spoken Language Translation, pp 24-31, 1997-7 H Tsukada et al., 97 Integration of grammar and statistical ... ("itada'~ are arranged in order of increasing probability It is therefore difficult to narrow the candidates into the correct character 'I~' ("itada") by the probability of character sequence alone...
- 5
- 588
- 0
Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx
Ngày tải lên :
31/03/2014, 07:20
... 5¢-TTAA GGATCCTAAGAACGAGACAGGCTGAACTCTCC-3¢; BCCPD67, 5¢-GTAACCATGGGTGAACAGGAAGA A- 3¢; BCCP-rev, 5¢-GGATCCTTAAACGTTTGTGTC TATAAG-3¢; BCCP K117L, 5¢-GAAGCTCTACTG GTTATGAAC-3¢ DNA was isolated ... mLÆmin)1 The total ion count in the range 500–2000 m/z was scanned at 0.1 s intervals The scans were accumulated and spectra combined and the molecular mass determined by the MAXENT AND TRANSFORM algorithms ... algorithms of the MASS LYNX software (MicroMass) Assay of A aeolicus BPL BPL activity was assayed by measuring the incorporation of [14C]biotin into purified BCCPD67, in a similar way to that described...
- 11
- 578
- 0
Báo cáo hóa học: " An exploration of job stress and health in the Norwegian police service: a cross sectional study" docx
Ngày tải lên :
20/06/2014, 00:20
... and design, acquisition, analysis and interpretation of data and drafting of the manuscript EH was involved in design, interpretation of data, drafting of the manuscript and supervision ØE was ... conception and design, interpretation of data, drafting of the manuscript and supervision BL was involved in analysis and interpretation of data AMB is the guarantor for this paper Acknowledgements The ... applied several validated international instruments The large number of respondents made multivariate analyses feasible The comparison with a nationwide cohort of Norwegian physicians is also a strength...
- 9
- 443
- 0
Báo cáo y học: "The nosological significance of Folie à Deux: a review of the literature" doc
Ngày tải lên :
08/08/2014, 21:20
... 18:321-355 World Health Organization: The ICD-10 Classification of Mental and Behavioural Disorders Geneva; 1992 American Psychiatric Association: Diagnostic and Statistical Manual of Mental Disorders ... categories accompanied with the relevant figures and tables for ease of explanation Demographic characteristics, family and psychiatric history (Figure 1) 1) Age: In the years 1993–2005 age was ... was in fact present in the secondaries in 28.6–54.1% of cases In the years 1993–2005, there was no statistically significant difference between the primary and the secondary in terms of the family...
- 8
- 433
- 0
báo cáo khoa học: " Does dissemination extend beyond publication: a survey of a cross section of public funded research in the UK" potx
Ngày tải lên :
10/08/2014, 10:23
... dissemination of research and to capture descriptions of their practices generally The second part of the questionnaire asked respondents to think about a particular grant rather than just their activities ... institutions alike What this study adds The focus on the traditional academic mediums of journals and conference presentations and ad hoc use of other available communication channels was also found ... disseminating the findings of their research Although we are aware of studies that explore the nature of dissemination activity in other countries [13,14], we are unaware of any previous survey that...
- 8
- 323
- 0
báo cáo khoa học:" Validation of the japanese version of the sarcoidosis health questionnaire: A cross-sectional study" pot
Ngày tải lên :
12/08/2014, 01:22
... accuracy of the data analysis: TH Conception and design: TH Analysis and interpretation of the data: KT, TH, TO Drafting of the article: KT Critical revision of the article for important intellectual ... variables in Japanese patients with sarcoidosis The reliability of the translated SHQ was assessed for internal consistency The Cronbach’s a values for all three domains and the total SHQ were above ... HRQOL of Japanese patients with sarcoidosis, and when added to routine radiological, serological and physiological evaluations of the disease, can provide valuable additional information As the SHQ...
- 6
- 282
- 0
Exploration of the functional significance of mig 2 in human cancer cell susceptibility to cytotoxic agents and cell growth control a pilot study
Ngày tải lên :
05/10/2015, 22:15
... GGACATGAG ddATP GGACA GGACATGA ddCTP ddTTP GGAC GGACATGAGC GGACAT GGGACATGATGAGCT CATGAGCT CATGAGC CATGAG CATGA CATG CAT CA C ILLUSTRATION 3-4 Principle of BigDye sequencing 37 3.9 Transfection ... chemotherapy program and a large scale of screening program for the discovery of new anticancer drugs Nowadays, there are approximately 60 drugs available for the treatment of various types of cancer ... which the activation of apoptosis can be abrogated and subsequent resistance may occur In addition to the relatively well-studied area of apoptosis, a number of other modes of cell death have been...
- 123
- 257
- 0
The Marketing Strategy of a multinational join stock company.doc
Ngày tải lên :
27/10/2012, 16:51
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...
- 25
- 623
- 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... DataTable named customersDT There is a row in the Orders table that also has a CustomerID of J6COM A copy of this row is stored in a DataTable named ordersDT The customersDT and ordersDT DataTable...
- 6
- 428
- 0
Tài liệu Human-Animal Bonds I: The Relational Significance of Companion Animals pdf
Ngày tải lên :
15/02/2014, 13:20
... companion animals not speak our language, they clearly understand and communicate with us in a myriad of ways Clinical Perspectives Research on the mental health impact of companion animals is augmented ... mortality Sadly, domesticated animals have often been badly abused by humans Their cruel treatment and exploitation in overwork and gaming sparked the advocacy of animal protection organizations ... Christianity came an annual ritual of ‘‘Blessing of the Animals’’ on church steps (Dresser, 2000) In Catholic parishes, this occurred on the Feast Day of St Francis of Assisi, the patron saint of animals...
- 20
- 508
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
Ngày tải lên :
19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
Ngày tải lên :
19/02/2014, 19:20
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... while mutants lacking a glutamine at the active site (Fe[Q69G] and Mn[Q14 6A] ) exhibit a large reduction, the manganese enzyme being reduced to an undetectable level (Table 1) The addition of a second...
- 12
- 740
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major ... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... calculations indicate that Glu144 has a slightly elevated pKa in the free enzyme that, at least in part, results from the vicinity of Asp215 (Table 3, rows and 4) The calculations indicate that the...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
Ngày tải lên :
08/03/2014, 02:21
... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... (grammar parsing) at least as accurately as the HMM This is assignment is a task that HHMMs are generally not well suited to Table shows the F1 -measures of identified semantic roles for each...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
Ngày tải lên :
08/03/2014, 09:20
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
Ngày tải lên :
08/03/2014, 22:20
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...
- 9
- 533
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
Ngày tải lên :
08/03/2014, 22:20
... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...
- 8
- 551
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
Ngày tải lên :
14/03/2014, 13:20
... studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are ... photon densities of mode and These equations (1), (2) have been solved numerically by the Matlab language with chosen values of parameters shown in Table (as seen in [12]) Table α1 = 1.1 β1 = ... Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation...
- 4
- 343
- 0