taymuriyya a isha ismat al 1840 1902 egyptian writer
Lagrangian analysis and prediction of coastal and ocean dynamics a griffa, et al , (cambridge, 2007) WW
Ngày tải lên :
05/05/2014, 14:42
... conduct a review of Lagrangian observations, analysis and assimilation methods in physical and biological oceanography, and to present new methodologies on Lagrangian analysis and data assimilation, ... Edmund Safra Campus, Givat Ram Jerusalem 92509 Israel Sara Pasquali CNR-IMATI via Bassini, 15 Milano I-20133 Italy Claudia Pasquero Earth System Science Dept University of California 3224 Croul Hall ... rotating Earth Predictability of Lagrangian motion in the upper ocean Lagrangian data assimilation in ocean general circulation models Dynamic consistency and Lagrangian data in oceanography: mapping,...
- 525
- 1.2K
- 0
cognitive therapy of substance abuse - a. beck, et. al., (guilford press, 1993)
Ngày tải lên :
12/05/2014, 17:20
... short-term and long-term benefits and disadvantages of using: the cost-benefits analysis (also called the advantages-disadvantages analysis; see Chapters and 10, this volume) The therapist also helps ... self-control training, community reinforcement, marital and family therapy, social skills training, and stress management, whereas approaches actually currently employed as standard practice in alcoholism ... enhance social and physical pleasure, (3) increase sexual performance and satisfaction, (4) increase power and aggression, (5) increase social assertiveness, and (6) decrease tension A similar...
- 371
- 303
- 0
History of Ancient Egyptian Obstetrics & Gynecology: A Review potx
Ngày tải lên :
28/03/2014, 14:20
... [4] Ghalioungui, P., Khalil, S., and Ammar, A. R Medical Historian 7:241-246 [5] Stevens, J.M Medical Journal of Australia 2:949-952, 1975 [6] Ghalioungui, P The House of Life: Magic and Medical ... with a pinch of natron, and also of acacia gum were commonly used Acacia gum has been shown to have a spermicidal effect in the presence of vaginal lactic acid. 5A most peculiar practice involved ... deal of their knowledge on papyrus scrolls Some of these papyri still exist today, and we have been able to translate them somewhat accurately, and learn a great deal about the study and practice...
- 5
- 341
- 0
borowiec a., cegla w., et al. (eds.) theoretical physics fin de siecle
Ngày tải lên :
24/04/2014, 17:16
... the so-called material waves or probability amplitudes This experimental fact actually destroys the classical concept of a particle as a physical object In consequence, also the philosophical concept ... his 60-th birthday Trapani n concentrates on a special class of the so called Banach partial *-algebras and discusses their physical relevance The materials in Chapter are based on modern concepts ... GERMANY,, Uzal N ZAKIROV e-mail: zakirov@sci.kcn.ru Department of General Relativity and Gravitation, Kazan State University, Kremljevskaja ul 18, RU-420008 Kazan, RUSSIA,, Kacper ZALEWSKI e-mail:...
- 311
- 779
- 0
camino al espanol a comprehensive course in spanish
Ngày tải lên :
04/05/2014, 14:51
... nacionalidad: idioma: nacionalidad: idioma: nacionalidad: idioma: nacionalidad: idioma: 17 ˜ C A M I N O A L E S PA N O L Pa´s ı Inglaterra Francia Espa˜ a n Italia Alemania Per´ u b Nacionalidad ... Nombre Rainer Hesse Riccardo Pavarotti Guadalupe Soler Juan Sant´s ı Dolores Ramos Gabriel M´ rquez a Nacionalidad alem´ n a italiano mexicana espa˜ ol n chilena colombiano Modelo A – ¡Hola! Buenas ... Espa˜ a; Francia; Nigeria; Egipto; Escocia; n Cuba; Alemania; Sierra Leona; Polonia; Gales; Argentina; Senegal; Roma; Londres; Madrid b Escucha y repite las siguientes palabras; f´jate en el acento...
- 451
- 628
- 0
color atlas of anatomy - a photog. study of the human body 7th ed. - j. rohen, et al., (lippincott, 2011)
Ngày tải lên :
12/05/2014, 16:54
... 29 Calvaria Calvaria (superior aspect) Calvaria (posterior aspect) Left parietal bone (external aspect) Left parietal bone (internal aspect) Frontal bone Coronal suture Sagittal suture Parietal ... Ethmoidal bone Nasal bone Nasomaxillary suture Lacrimal bone Lacrimomaxillary suture Ethmoidolacrimal suture Zygomatic bone Anterior nasal spine Maxilla Mandible Mental foramen Mental protuberance ... the palatine bone and maxilla are attached laterally; the small nasal and lacrimal bones fill the remaining spaces Cartilages remain only in the external part of the nose 23 104750_S_019_063_Kap_2_1:_...
- 548
- 2.2K
- 0
color imaging - fundamentals and applications - e. reinhard, et al., (a k peters, 2008)
Ngày tải lên :
12/05/2014, 17:03
... with spatial orientation Materials which exhibit a variation in material constants with spatial orientation are called anisotropic 2.2 Waves Maxwell’s equations form a set of simultaneous equations ... Cirloganu, Kadi Bouatouch, Dani Lischinski, Ranaan Fattal, Alice Peters, Franz and Ineke Reinhard, Gordon Kindlmann, Sarah Creem-Regehr, Charles Hughes, Mark Colbert, Jared Johnson, Jaakko Konttinen, ... in image formation, as well as issues related to digital sensors This chapter also includes sections on camera characterization, and more specialized capture techniques such as holography and...
- 1K
- 686
- 0
![correlative neurosciences - [part a - fundamental mechanisms] - t. tokizane, et al., (elsevier, 1966)](https://media.store123doc.com/images/document/14/y/rk/medium_ciDEk95o3t.jpg)
correlative neurosciences - [part a - fundamental mechanisms] - t. tokizane, et al., (elsevier, 1966)
Ngày tải lên :
12/05/2014, 17:32
... hypothalamic periventricular stratum (a- parasympathetic zone) and the lateral preoptic area to the lateral hypothalamic area (c-parasympathetic zone), and they all react parasympathetically The ... the medial preoptic area is a continuation of the medial hypothalamic area (b-sympathetic zone), and the lateral preoptic area is a continuation of the lateral hypothalamic area (c-parasympathetic ... hippocampus; AHM, medial hypothalamic area; AM, anteromedial thalamic nucleus; APL, lateral preoptic area; APM, medial preoptic area; AV, anteroventral thalamic nucleus; BOLF, olfactory bulb; (C),...
- 377
- 246
- 0
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx
Ngày tải lên :
20/06/2014, 01:20
... http://www.virologyj.com/content/5/1/13 AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... 1722 243 -GTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAGAAAGGTGGCGGCT || |||||| || | |||||| |||||||||||||| || |||||||| || ||||||| 1723 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT ... TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ||||||||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| 1544 TGGACCCGTTTCATGGAAGACAGCTTCCCTATCGTGAACGACCAAGAAATTATGGACGTG 63 1543...
- 11
- 854
- 0
Báo cáo toán học: " Interface modification effect between p-type a-SiC:H and ZnO:Al in p-i-n amorphous silicon solar cells" potx
Ngày tải lên :
20/06/2014, 20:20
... well as optical properties such as transparency and haze ratio Additionally, the interface properties with an adjacent p-layer are also important The FTO has been widely used as a front TCO in a ... potential barrier at the interface of AZO and p-type a- SiC:H is made gradual by inserting a buffer layer A few-nanometer-thick nanocrystalline silicon buffer layer between the AZO and a- SiC:H enhances ... interface between the AZO and p-layer with and without the buffer layers simulated by ASA At the depth of about 801 nm, it is seen that although the barrier height at the valence band actually...
- 14
- 275
- 0
![Báo cáo hóa học: " Comment on “on the stability of quadratic double centralizers and quadratic multipliers: a fixed point approach” [Bodaghi et al., j. inequal. appl. 2011, article id 957541 (2011)]" pot](https://media.store123doc.com/images/document/2014_06/20/medium_bto1403277608.jpg)
Báo cáo hóa học: " Comment on “on the stability of quadratic double centralizers and quadratic multipliers: a fixed point approach” [Bodaghi et al., j. inequal. appl. 2011, article id 957541 (2011)]" pot
Ngày tải lên :
20/06/2014, 22:20
... ∈ A , and a mapping R : A → A is a quadratic right centralizer if R is a quadratic homogeneous mapping and R(ab) = a2 R(b) for all a, b ∈ A Also a quadratic double centralizer of an algebra A ... centralizer and aL( b) = R (a) b for all a, b ∈ A An operator T : A → A is said to be a multiplier if aT(b) = T (a) b for all a, b ∈ A Throughout this article, let A be a complex Banach algebra Recall ... that a mapping L : A → A is a quadratic left centralizer if L is a quadratic homogeneous mapping, that is quadratic and L(la) = l2 L (a) for all a ∈ A and l Î ℂ and L(ab) = L (a) b2 for all a, ...
- 7
- 366
- 0
Báo cáo hóa học: "A study on the impact of AL-FEC techniques on TV over IP Quality of Experience" doc
Ngày tải lên :
20/06/2014, 22:20
... Battisti et al EURASIP Journal on Advances in Signal Processing 2011, 2011:86 http://asp.eurasipjournals.com/content/2011/1/86 broadcasting international standards) is analyzed in realtime ... the receiver The analytical approximation of the residual PLR also for the 2D-FEC allows to evaluate the perceived quality as a function of the inserted redundancy and of the actual PLR in the network ... with the subjective quality scores, the NTIA General VQM was adopted both as a national standard and as an international recommendation The model returns values in the range from zero to one,...
- 16
- 593
- 0
báo cáo hóa học:" Research Article Krasnosel’skii-Type Fixed-Set Results M. A. Al-Thagafi and Naseer Shahzad" pdf
Ngày tải lên :
21/06/2014, 11:20
... with application to set differential equations,” Set-Valued Analysis, vol 14, no 3, pp 263–272, 2006 12 C Chifu and A Petrusel, “Multivalued fractals and generalized multivalued contractions,” Chaos, ... Clearly A is nonempty since L ∈ C Then A ⊆ S A S A T A It follows that A y ⊆S A T A ⊆S A y and hence A ∪ {y} ∈ C and y ∈ A Thus S A T A T A y , T A Take y ∈ 3.9 A Theorem 3.6 Let M be a nonempty ... References M A Krasnosel’ski˘, “Some problems of nonlinear analysis,” in American Mathematical Society ı Translations, vol 10 of 2, pp 345–409, American Mathematical Society, Providence, RI, USA, 1958...
- 9
- 292
- 0
báo cáo hóa học:" Research Article Fixed Point Results in Quasimetric Spaces Abdul Latif and Saleh A. Al-Mezel" pdf
Ngày tải lên :
21/06/2014, 11:20
... multi-valued contractive mappings and multi-valued Caristi type mappings,” Journal of Mathematical Analysis and Applications, vol 317, no 1, pp 103–112, 2006 O Kada, T Suzuki, and W Takahashi, ... 2008 A H Siddiqi and Q H Ansari, “An iterative method for generalized variational inequalities,” Mathematica Japonica, vol 34, no 3, pp 475–481, 1989 H Kaneko, “Generalized contractive multivalued ... Theory and Applications Clearly, the class of weakly q-contractive maps contains the class of weakly contractive maps, and the class of generalized q-contractive maps contains the classes of generalized...
- 8
- 276
- 0
báo cáo hóa học:" Interface modification effect between p-type a-SiC:H and ZnO:Al in p-i-n amorphous silicon solar cells" pot
Ngày tải lên :
21/06/2014, 17:20
... well as optical properties such as transparency and haze ratio Additionally, the interface properties with an adjacent p-layer are also important The FTO has been widely used as a front TCO in a ... potential barrier at the interface of AZO and p-type a- SiC:H is made gradual by inserting a buffer layer A few-nanometer-thick nanocrystalline silicon buffer layer between the AZO and a- SiC:H enhances ... interface between the AZO and p-layer with and without the buffer layers simulated by ASA At the depth of about 801 nm, it is seen that although the barrier height at the valence band actually...
- 14
- 229
- 0
Báo cáo hóa học: " Holoprosencephaly in an Egyptian baby with ectrodactyly-ectodermal dysplasia-cleft syndrome: a case report" doc
Ngày tải lên :
21/06/2014, 19:20
... brain’ While this statement is generally true, identical facial features are occasionally recognized in the absence of HPE Also, facial abnormalities are not invariably present, so that reliance ... hair with hypotrichosis; xerostomia; dystrophic nails; and dental enamel hypoplasia with microdontia Associated anomalies include blepharophimosis, lacrimal duct anomalies, deafness, choanal atresia ... Metwalley Kalil and Fargalley Journal of Medical Case Reports 2012, 6:35 http://www.jmedicalcasereports.com/content/6/1/35 Page of Figure Ectrodactyly of hands cleft palate Her scalp hair was sparse...
- 5
- 254
- 0