table a 7 exslt common module functions

... possible strategy *In such a methodology ,the teacher has a syllabus of topics ,but may or may not have ready made texts or lists of actual language samples that are to be taught The main initiative ... and situations are communicative events Notions and functions are the ways particular meanings are realized in language For example – a topic is “the family”, a situation is “visiting a friend’s ... versa 8 Teaching chunks of language; from task to text *Teaching topics, situations,notios and function through task and learner-limitiated language rather than through ready –made texts is another...

Ngày tải lên: 13/07/2014, 23:13

Ngày tải lên: 08/08/2014, 10:22

... câu cho 0,5 điểm -c - a -d -b IV/(2 điểm) Mỗi câu cho 0,5 điểm 1.They start at o’clock she usually talks to her friends Yes she is Her favorite subjects are English and Math V/(1 điểm) Mỗi câu ... HƯỚNG DẪN CHẤM ĐỀ KIỂM TRA CHẤT LƯỢNG HỌC KỲ I MÔN ANH I/(3 điểm) Mỗi câu cho 0,5 điểm 1.on 2.play 3.fewer 4.drink who 6.reading II/ (2 điểm) Mỗi câu cho 0,5 điểm 1.watches 2.are skipping going will ... favorite subjects are English and Math V/(1 điểm) Mỗi câu cho 0,5 điểm 1.He usually goes to Lan’s house on weekend When you have English ...

Ngày tải lên: 28/06/2013, 01:25

... Mỗi câu cho 0,5 điểm They start at 7o’clock she usually talks to her friends yes she is Her favorite subjects are English and Math IV/(2 điểm) Mỗi câu cho 0,5 điểm 1.At from of with V/(1 điểm) ... KIỂM TRA CHẤT LƯỢNG HỌC KỲ II MÔN ANH I/(2 điểm) Mỗi câu cho 0,5 điểm 1.watches 2.are skipping 3.going 4.will visit II/ (3 điểm) Mỗi câu cho 0,5 điểm 1.on 2.play fewer drink 5.who 6.reading III/(2 ... câu cho 0,5 điểm 1.At from of with V/(1 điểm) Mỗi câu cho 0,5 điểm 1.He usually goes to Lan ‘s house on weekend When you have English ...

Ngày tải lên: 28/06/2013, 01:25

... xếp theo thứ tự từ Bắc vào Nam (2đ) a Đảo Lý Sơn - đảo Bạch Long Vó – đảo Cồân Cỏ – đảo Phú Quý b.1.C a ChaLo-2 C a Nạàm Cắn –3 c a Cầu -4.C a Lao Bảo – Trường Phan Bội Châu Tên: Lớp: 9/ Điểm ... lớn biết chữ nhiều a. Đúng b.Sai Nối ô bên trái với ô bên phải.2đ Vườn quốc gia Thuộc tónh a Bạch Mã Thanh Hoá b Phong Nha – Kẻ Bàng Nghệ An c Pù Mát Quảng Bình d Bến En Th a Thiên Huế Trả lời: ... xếp theo thứ tự từ Băéc vào Nam (2đ) a. 1.Đảo Phú Quý-2 Đảo Lý Sơn – 3.Đảo Bạch Long Vó –4 Đảo Cồân Cỏ ù b.1 C a Nạàm Cắn -2.c a Cầu Treo –3 c a Lao Bảo – 4.c a ChaLo ...

Ngày tải lên: 10/09/2013, 07:10

... xếp theo thứ tự từ Bắc vào Nam (2đ) a Đảo Lý Sơn - đảo Bạch Long Vó – đảo Cồân Cỏ – đảo Phú Quý b.1.C a ChaLo-2 C a Nạàm Cắn –3 c a Cầu -4.C a Lao Bảo – Trường Phan Bội Châu Tên: Lớp: 9/ Điểm ... lớn biết chữ nhiều a. Đúng b.Sai Nối ô bên trái với ô bên phải.2đ Vườn quốc gia Thuộc tónh a Bạch Mã Thanh Hoá b Phong Nha – Kẻ Bàng Nghệ An c Pù Mát Quảng Bình d Bến En Th a Thiên Huế Trả lời: ... xếp theo thứ tự từ Băéc vào Nam (2đ) a. 1.Đảo Phú Quý-2 Đảo Lý Sơn – 3.Đảo Bạch Long Vó –4 Đảo Cồân Cỏ ù b.1 C a Nạàm Cắn -2.c a Cầu Treo –3 c a Lao Bảo – 4.c a ChaLo ...

Ngày tải lên: 10/09/2013, 12:10

... Quang cảnh nơng thơn Quang cảnh thi ̣ Hoa ̣t ̣ng kinh tế ở nơng thơn Hoa ̣t ̣ng kinh tế ở thi ̣ Qua các hình a nh vư a quan sát kế t hơ ̣p với sự hiể u biế t cu a bản thân , hay ... HOA – CAC SIÊU ĐƠ THI ̣ Đơ thi ̣ho a là xu thế cu a thế giới ngày nay.Nhiề u thi ̣phát triể n nhanh chóng trở thành các siêu thi.̣ Nớ i ý ̣t A phù hơ ̣p với ̣t B A B Nhà cư a ... cơng ́nghiệ ,̣pLa ma ) n là lúc a có trao đở i hàng ho a thơi cở a ̣i ( TQ,Ai câ ̣p,Ân phát triể , ̃ Vậy quá trinh phát triển thi ̣gắ n liền với quá trinh phát triể n thương...

Ngày tải lên: 16/09/2013, 03:10

... b, Vụ hè thu: Từ tháng 4- T7 b, vụ hè thu : từ tháng 4- VD: L a, ngô, khoai VD: l a, ngô, khoai c, Vụ m a: Từ T6- T11 c, Vụ m a: từ tháng 6- 11 VD: L a, rau VD: L a, rau * Xử lý hạt giống: f, Vụ ... luân canh, xen canh, tăng vụ * Tên loại trồng - Ở đ a phương em trồng loại l a gì? Sau gặt l a trồng tiếp gì? Thu hoạch trồng n a? -> Đó hình thức luân canh - GV: Đ a 1, VD -> đònh ngh a SGK ... dụng cụ HS: than củi, kẹp gắp than, th a, diêm, nước cất… -Chia nhóm thực hành phân chia mẫu phân bón cho nhóm thưc hành Hoat động : Thực hành quy trình - Bước1 : GV thao tác mẫu,HS quan sát -Bước...

Ngày tải lên: 16/09/2013, 13:10

... (6) 55 56 Unit 9: A2 57 Unit 9: A3 -4 - Luyện kỹ nghe hiểu đoạn văn chuyến gia đình Robinson đọc hiểu tìm thông tin trang nhật ký Ba 58 Unit 9: B1- 59 20 Unit 9: At home and way A1 Unit 9: B3- - ... Language Focus - Ôn luyện, làm tập với tiếp diễn, trạng từ tần suất với đơn Written test - Kiểm tra đánh giá kiến thức học HS qua học 4, 5, Rèn kỹ viết đọc hiểu cho HS Unit 7: At home and away ... cân bằng, hợp lý, hợp vệ sinh 77 Unit 12: B4 78 Language focus SGK, SGV Giáo án Băng đài - Luyện nghe để tìm thông tin thức ăn, đồ uống bảng phụ mà Lan, Ba, Nga Hoa ăn uống - Luyện tập với khứ...

Ngày tải lên: 20/09/2013, 08:10

... Khoanh tròn vào chữ đầu câu trả lời đúng: Sự bùng nổ dân số giới xảy tỉ lệ bình quân hàng năm vượt quá: A 2,1 % .B 2,3 % C 2,4 % D 2,5 % Nguyên nhân dân số giới gia tăng nhanh kỉ XIX kỉ XX do: A ... B.Công nghiệp phát triển C Tiến y tế D Ý A C Sự phân bố dân cư giới : A Đồng B Không đồng đề C Không thành thị nông thôn D.Tất ý sai Nguyên nhân phân bố : A Do điều kiện tự nhiên B Do điều kiện ... cực tới (2) Và (3) Việc giảm tỉ lệ gia tăng dân số góp phần (4) Và nâng cao đời sống nhân dân đới nóng.” II Tự Luận (7 iểm) Câu (2đ): Quan sát hình 5.2 cho biết biểu đồ thuộc kiểu môi...

Ngày tải lên: 11/10/2013, 13:11

... sau:( Nông nghiệp; Công nghiệp; Mật độ th a; Mật độ cao.) Em chọn cụm từ điền vào chỗ trống câu sau cho 1- Hoạt động kinh tế quần cư nông thôn chủ yếu (1)……… Nhà c a (2)…… .… gắn với đất đai ... (3 điểm) Câu (1đ): Khoanh tròn vào ý em cho câu Trên giới có chủng tộc : A Một chủng tộc B Hai chủng tộc C Chủng tộc C Chủng tộc Dân cư Việt Nam chủ yếu thuộc chủng tộc A - Môn gô lô B - Nê grô ... thị (3)……… Nhà c a tập trung với(4)… Câu 3(1đ): Nối ý cột A với cột B cho hợp lý Cột A: Môi trường: Ý nối Cột B: Vị trí: Xích đạo ẩm 1A Từ chí tuyến Bắc đến chí tuyến Nam Nhiệt đới 2B 50B...

Ngày tải lên: 11/10/2013, 13:11

... enter the data in and analyze if you have access to SPSS If you not have access to SPSS, the data can also be converted to other data analysis programs by your campus research department ... It is a guide, but it also helps hold you and your team accountable for assignments Also, it is easier to evaluate the impact and success of a plan that is in writing Sections for the plan might ... reach all of them Identify Tactics to Communicate to Key Audiences Communication tactics may include traditional channels, such as media (television, radio, newspapers and magazines) and Web...

Ngày tải lên: 17/10/2013, 12:15

... Match a job with an activity : A teacher a grows vegetables and raises cattle A farmer b writes for a newspaper A doctor c learn a lot of things at school A journalist d teaches at a school A ... Lesson A1 -Listen Then practice with a partner Uncle: Eat your breakfast Hoa It’s haft past six You’ll be late for school Hoa: I won’t be late, uncle I’m usually early Our classes start at 7. 00 ... Uncle: And what time your classes finish ? Hoa: At a quarter past eleven Then in the afternoon I my homework That takes about two hours each day Uncle: You work quite hard, Hoa When will you have a...

Ngày tải lên: 18/10/2013, 14:11

... 21 David’s going to be given a big surprise 22 Considerable damage has been caused by the fire 23 Why was the house built so close to the road? 24 The old theatre ... speak English all over the world 26 I haven’t seen him for month 27 Who wrote this article ? 28 Nobody has used this bicycle for many years 29 You have ... hundreds of pupils 37 They have just seen the new teachers in the school yard 38 He doesn’t admire this actor 39 Did the cartoon attract the children ? ...

Ngày tải lên: 27/11/2013, 03:11

... dont have Easter or Christmas vacation American students often play scoring goals, swap baseball cards or talk and eat at recess They have chicken, potato, fruits on their Thanksgiving They also ... celebrate Easter, Christmas and New Year What Vietnamese students often at recess ? - Do they have Christmas vacation ? - What American students have on their Thanksgiving ... văn sau trả lời câu hỏi (2đ) Viet Nam is sometimes different from America Vietnamese students often play marbles, read books or skip rope at recess They have Tet vacation and summer holiday They...

Ngày tải lên: 27/11/2013, 04:11

... Grammar: Comparative and superlative Vocabulary: Nguyen Thi Thanh Tam School year 2009 2010 Page 20 Tan Hung Tay Secondary School Phu Tan distrist- Ca Mau province English7 Apartment, flat, ... the tape Ask and answer: - Asks ps to practice the a/ Hes a farmer Nguyen Thi Thanh Tam School year 2009 2010 Page 17 Tan Hung Tay Secondary School Phu Tan distrist- Ca Mau province dialogue ... Teacher asks questions and ps - Look at the picture the table answer and answer b- Ask and answer: - Ask ps to works in pairs to - Work in pairs: Is there a. ? ask and answer about things in A: ...

Ngày tải lên: 29/11/2013, 23:11

... Grammar: Comparative and superlative Vocabulary: Nguyen Thi Thanh Tam School year 2009 2010 Page 20 Tan Hung Tay Secondary School Phu Tan distrist- Ca Mau province English7 Apartment, flat, ... the tape Ask and answer: - Asks ps to practice the a/ Hes a farmer Nguyen Thi Thanh Tam School year 2009 2010 Page 17 Tan Hung Tay Secondary School Phu Tan distrist- Ca Mau province dialogue ... Teacher asks questions and ps - Look at the picture the table answer and answer b- Ask and answer: - Ask ps to works in pairs to - Work in pairs: Is there a. ? ask and answer about things in A: ...

Ngày tải lên: 29/11/2013, 23:11

... is a big moment You're about to create your account— your Administrator account, in fact, as described in Chapter 12 All you have to is make up a name, usually a short variation of your name and ... iPhoto, and so on (If you have a Mac account—see Section 18.6—put that account info here Registration Information This is your chance to become a grain of sand on the great beach of the Apple database ... without having to install the whole darned thing What you need is Pacifist, a shareware program that lets you install individual files and folders from the archipelago that is the collection of Mac...

Ngày tải lên: 14/12/2013, 13:15

... students actually make many grammatical and lexical mistakes, which urges me to choose a study on grammatical and lexical errors made by first year English major students at Haiphong Private University ... went through all his money This is the table of common separable & inseparable phrasal verbs we often make mistakes: Separable phrasal verbs Inseparable phrasal verbs bring up call on fill up ... are synonymous is they have similar meaning and are often used interchangeably But look a little closer at common synonyms, and you'll realize that the two words aren't always 100% the same and...

Ngày tải lên: 14/12/2013, 16:45

... S., Kasai, N., Shimazaki, N., Takemura, M., Asahara, H., Linn, S., Yshida, S., Matsukage, A. , Koiwai, O., Sugawara, F., Yoshida, H & Sakaguchi, K (2002) A plant phytotoxin, solanapyrone A, is an ... overlap extension using the polymerase chain reaction Gene 77 , 51–59 Kimura, S., Suzuki, T., Yanagawa, Y., Yamamoto, T., Nakagawa, H., Tanaka, I., Hashimoto, J & Sakaguchi, K (2002) Characterization ... sequence of 75 -mer oligonucleotide is 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢ [3H]dTTP (10 lM; 10 CiÆmmol)1) and enzymes were added as indicated in the...

Ngày tải lên: 07/03/2014, 15:20