t cells as officers rather than troops

... replication in the lung Thus, it is not the virus bearing the epitope nor local virus replication that results in the decreased functionality of CD8+ CTL in lungs, but rather the pulmonary site of ... residence of the cells Therefore, the conclusion that RSV infection specifically impairs CD8+CTL functionality [1], and the hypothesis that this might contribute to RSV re-infection, must be reassessed ... tetramer+CD8+ T cell response (23% of total CD8+ cells) was detected in the lungs (Table 1) A somewhat lower response (15%) of tetramer+CD8+ cells was detected in the lungs after IN infection with VV-M2...

Ngày tải lên: 20/06/2014, 01:20

... GTT GTT CTC GT-3' mTLR4 upper 5'-AGC CGG AAG GTT ATT GTG GTA GT-3' mTLR4 lower 5'-TGC CGT TTC TTG TTC TTC CTC T- 3' mTLR6 upper 5'-ATA CCA CCG TTC TCC ATT T- 3' mTLR6 lower 5'-GAC GTG CTC TAT CAT ... GGT CAT GGG AAT AAC-3' mTLR1 upper 5'-GGC ATA CGC CAG TCA AAT A-3' mTLR1 lower 5'-ATG CAG AAA TGG GCT AAC TT-3' mTLR2 upper 5'-TCT GCT GTG CCC TTC TCC TGT TGA-3' mTLR2 lower 5'-GGC CGC GTC GTT ... that bacterial lipoproteins directly stimulate alloreactive CTLs to proliferate and to secrete IFN-γ via TLR-2 adds another facet to the functional potential of T effector cells The fact that...

Ngày tải lên: 09/08/2014, 01:23

... Evidence that the T cell repertoire of normal rats contains cells with the potential to cause diabetes Characterization of the CD4+ T cell subset that inhibits this autoimmune potential J Exp ... activating them with TGF-β An adoptive immunotherapy using the patients own T cells that have regained a protective function they had lost should lack the serious toxic effects associated with ... death of some T cells [48,49], while others observed that this cytokine protected T cells from apoptosis [50,51] We favor the hypothesis that TGF-β promotes the death of mature Th1 and Th2 cells...

Ngày tải lên: 09/08/2014, 03:24

... scores was found between rats treated with empty anti-CD134 liposomes and rats treated with empty, bare liposomes (data not shown) tion by activated CD4 T cells in vitro Anti-CD134-mediated+targeting ... cells to Mt HSP60211–225, which was reported not to be related to AA [16], indeed indicated that a part of the CD134+ T cells was not activated in relation to clinical disease but responded to ... model, the first signs of clinical disease become manifest between days 10 and 14, and at about this time T cells start to infiltrate the joints [17] The present data therefore suggest that early in...

Ngày tải lên: 09/08/2014, 06:22

... platelets, macrophages, endothelial cells, fibroblasts, epithelial cells, and mast cells, have the capacity to generate RANTES [8], which directly supported the potential role of RANTES in asthma The ... of RANTES -28C/G associated with asthma risk and to quantify the potential between-study heterogeneity, we conducted a meta-analysis on published case-control studies with 1894 asthma cases and ... and case-control studies of ethnicity (1894 cases and 1766 controls) were available for this meta-analysis The χ2-based Q statistic test was used for the assessment of heterogeneity, and it was...

Ngày tải lên: 26/10/2012, 09:39

... we use the notation {s, t, “D”} to denote that the s-th bunsetsu modifies the t- th one The use of “O” instead of “D” indicates that the s-th does not modify the t- th That is generating {s, t, “D”} ... means vectors which are selected in the training phase and contribute to the prediction Thus it is very important to construct models for estimating the actual annotation cost as Haertel et al (2008) ... not true in an actual annotation work.8 In addition, we have to note that it may be easier to annotate a whole sentence than some bunsetsu pairs in a sentence9 In a real annotation task, it...

Ngày tải lên: 20/02/2014, 04:20

... chu t vào t để bi t thể loại t t câu: (Các bạn kích chu t lần vào t để bi t thêm chi ti t từ đó) David prefers to live in the country rather than in the city 2 Các bạn di chu t vào cụm t ... “in the city”- thành thị - rather than - là: Trong “ rather trạng t (abverb) có nghĩa là, thích …hơn than liên t ( conjunction) có nghĩa hơn(để diễn đ t so sánh) Ở “ rather than dùng cấu trúc ... prefers to live in the country rather than live in the city Hình thức ngữ pháp : Cấu trúc “ prefer to something rather than (do) something else” – ( thích làm việc việc kia) Chúng ta quan s t câu...

Ngày tải lên: 26/02/2014, 00:20

... IV and type VI) Interestingly, addition of TG stimulated the induction of the four PLA2 isotypes in Jurkat T- cells PLA2 inhibitors that inhibit AA release diminish the TG-induced capacitative calcium ... inhibited the TGinduced release [3H]AA almost with the same order of magnitude as BEL Figure shows that Jurkat T- cells constitutively express the mRNA of four PLA2 isotypes (type IB, type V, type ... impregnated with ethidium bromide The RNA pattern was visualized by UV transillumination Statistical analysis Results are shown as mean ± SEM Statistical analysis of data was carried out using STATISTICA...

Ngày tải lên: 08/03/2014, 09:20

... 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢; ... CCTCCTCACCGGATCCTCCACCTCCAGAACCACCACCCCC-3¢; primer 13, 5¢-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3¢; primer 14, 5¢-CGTCTCCTCA GGGGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3¢ In all ... 5¢-CGAATGC GGCCGCAGCTGATGCTGCACCAACTGTATCC-3¢ and reverse primer 5¢-CGAATGCGGCCGCACACTCATTCC TGTTGAAGCTCTTGAC-3¢ The PCR product for the CL(j) region was digested with NotI and cloned into the NotI...

Ngày tải lên: 16/03/2014, 14:20

... proteins, but also to quantitatively investigate protein– protein interactions The recruitment and localization of LAT and LAT-binding proteins to the sites of receptor activation has been extensively ... sufficient for TCR-mediated MAP kinase activation [17] This indicates that recruitment of the Grb2–Sos complex to the plasma membrane, via its association with LAT at these sites, is not sufficient for ... previously, that these molecules closely, but indirectly, associate with LAT [51] In contrast, SLP-76 demonstrated substantial FRET with Nck, indicating that SLP-76 binds directly to this protein [51]...

Ngày tải lên: 23/03/2014, 15:21

... respectively The NFAT-Luc reporter was constructed by inserting an oligonucleotide encoding the NFAT binding site of the FasL promoter (5¢-ATTGTGGGCGGAAACTTCCAG-3¢) with additional GATC motifs at the ... the FasL promoter Therefore, it is possible that the activities of RA are mediated through transcriptional modulation by other nuclear transcriptional factors, such as NFAT and SP-1 To test this ... translation initiation site, and transcription starts from nucleotide )181 [22] (B) Each reporter construct was transiently transfected into Jurkat cells Transfected cells were stimulated with PMA (25...

Ngày tải lên: 24/03/2014, 03:21

... EcoRI, and ligated into EcoRI digested pGEX- 2T vector The SLP-76-Pro–GST plasmid was constructed using the primers 5¢-CGAGGGATCCCT GCAGAACTCCATCCTGCCTG-3¢ and 5¢-CATTTAAT GAATTCTCTTCCTCCGC-3¢ corresponding ... Shb–PTB–GST plasmid was constructed using the primers 5¢-GGGATCCTTCCAGGACCCCTAC-3¢ and 5¢-AGAATTCAGGGCTCCCATGTTT-3¢ corresponding to the Shb cDNA nucleotides 840–1740 The amplified fragment was digested ... found that Shb associates with the SH2 domain of SLP-76, but not to the proline-rich regions of SLP-76 (Fig 2D), and that this association was increased by CD3-stimulation To test this further,...

Ngày tải lên: 24/03/2014, 04:21

... levels of T- bet, and Itk may regulate the expression of this critical transcription factor Indeed, it has been suggested that Itk regulates T- bet levels in iNKT cells in the thymus, and that thymic ... activation may be due to regulated by Itk Depiction of the signaling pathway used by the TCR and cd T cells Note that in the case of the TCR, these pathways seem to be but lead to different developmental ... restrains Given that both cell types can secrete IL-4, it is likely that the production of this cytokine, and the T- cell types that can produce it, need to be tightly controlled Like iNKT cells, ...

Ngày tải lên: 28/03/2014, 22:21

... samples The response rate estimates the fraction of all eligible respondents in the sample that were ultimately interviewed At PSRAI it is calculated by taking the product of three component rates: ... options as the main reason why they primarily use their phone to go online, with 6% saying that they not have access to a computer and 4% saying that they not have any other source of internet ... Contact rate – the proportion of working numbers where a request for interview was made Cooperation rate – the proportion of contacted numbers where a consent for interview was at least initially...

Ngày tải lên: 29/03/2014, 20:20

... cells was slightly, but significantly, larger than that in untreated cells (P < 0.05, t- test), whereas the receptor-induced portion of the Ins(1,4,5)P3 increase was significantly smaller in Tg-pretreated ... increase was 79.6 ± 7.4% of that induced by reintroduced calcium, whereas for the pretreated cells it was, 39.8 ± 3.0%, which was significantly lower (P < 0.01, t- test) than for untreated cells The ... it is likely that the same effect may account for the finding that the total Ins(1,4,5)P3 increase induced by receptor activation and calcium entry was slightly larger in the absence than in the...

Ngày tải lên: 30/03/2014, 03:20

... descriptors covered by the metadata profile: Information about the dataset as a whole: contact information, dataset title and abstract, etc Information about each indicator in the dataset: name, ... implemented by the computer science research team LIG, but it is important to note that other partners and experts of the project contributed to this work In particular, the UAB team has contributed ... the studied topic In this phase, the thematic expert assesses whether the indicators and values present in the dataset are well described, whether the completeness of the dataset is satisfactory...

Ngày tải lên: 30/03/2014, 22:20

... exist to explain the motion of material in our galaxy, we find that the ratio of total matter to visible matter is not to , but closer to to If this is not a mistake, then the dark matter cannot ... during the lifetimes of the greatest astronomers, and Kepler certainly fits the bill Starting out as a humble mathematics teacher in Austria, Kepler became assistant to the astronomer Tycho Brahe ... quite stopping Determining the amount of dark matter, and thus the total density of mass in the universe, therefore promised to reveal the answer to the age-old question (at least as old as T...

Ngày tải lên: 05/06/2014, 11:24

... find that the ratio of total matter to visible matter is not to 1, but closer to 10 to If this is not a mistake, then the dark matter cannot be made of protons and neutrons There are just not enough ... and those that are twice as far away are moving twice as fast, those that are three times away three times as fast, etc.—it seems obvious what this implies: We are the center of the universe! As ... during the lifetimes of the greatest astronomers, and Kepler certainly fits the bill Starting out as a humble mathematics teacher in Austria, Kepler became assistant to the astronomer Tycho Brahe...

Ngày tải lên: 11/06/2014, 12:02

... as the percentage of the total population of CD8+ T cells that were double positive (CD8+pentamer+) Cytotoxicity assays The cytotoxicity assays were performed by flow cytometry CTL assay that ... factors in the supernatant inhibit the maturation of fusion cells and have a negative impact in the stimulation of T cells To determine the induction of WT1-specitic CD8+ T cells, a pentameric assay ... caspase-3 activation in target cells through detection of specific cleavage of fluorogenic caspase-3 [36,37] The fusion cells could prime naive T cells to differentiate into CTL with lytic activity...

Ngày tải lên: 18/06/2014, 15:20

... Cytotoxicity of In Vivo Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination (the time point associated with the ... production of T cells that not recognize tumour cells in vivo based on this epitope [67-69] In contrast to these studies, the ability of our vaccination strategy to generate tetramer+ CD8 +T cells specific ... substantial generation of tetramer+, CD8+, T cells In fact, the responses generated to the two DC preparations were atypical only in this particular patient The remaining patients showed the pattern...

Ngày tải lên: 18/06/2014, 15:20