t cells as officers rather than troops

Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

Ngày tải lên : 20/06/2014, 01:20

... replication in the lung Thus, it is not the virus bearing the epitope nor local virus replication that results in the decreased functionality of CD8+ CTL in lungs, but rather the pulmonary site of ... residence of the cells Therefore, the conclusion that RSV infection specifically impairs CD8+CTL functionality [1], and the hypothesis that this might contribute to RSV re-infection, must be reassessed ... tetramer+CD8+ T cell response (23% of total CD8+ cells) was detected in the lungs (Table 1) A somewhat lower response (15%) of tetramer+CD8+ cells was detected in the lungs after IN infection with VV-M2...

8
381
0

Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

Ngày tải lên : 09/08/2014, 01:23

... GTT GTT CTC GT-3' mTLR4 upper 5'-AGC CGG AAG GTT ATT GTG GTA GT-3' mTLR4 lower 5'-TGC CGT TTC TTG TTC TTC CTC T- 3' mTLR6 upper 5'-ATA CCA CCG TTC TCC ATT T- 3' mTLR6 lower 5'-GAC GTG CTC TAT CAT ... GGT CAT GGG AAT AAC-3' mTLR1 upper 5'-GGC ATA CGC CAG TCA AAT A-3' mTLR1 lower 5'-ATG CAG AAA TGG GCT AAC TT-3' mTLR2 upper 5'-TCT GCT GTG CCC TTC TCC TGT TGA-3' mTLR2 lower 5'-GGC CGC GTC GTT ... that bacterial lipoproteins directly stimulate alloreactive CTLs to proliferate and to secrete IFN-γ via TLR-2 adds another facet to the functional potential of T effector cells The fact that...

14
505
0

Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

Ngày tải lên : 09/08/2014, 03:24

... Evidence that the T cell repertoire of normal rats contains cells with the potential to cause diabetes Characterization of the CD4+ T cell subset that inhibits this autoimmune potential J Exp ... activating them with TGF-β An adoptive immunotherapy using the patients own T cells that have regained a protective function they had lost should lack the serious toxic effects associated with ... death of some T cells [48,49], while others observed that this cytokine protected T cells from apoptosis [50,51] We favor the hypothesis that TGF-β promotes the death of mature Th1 and Th2 cells...

6
408
0

Báo cáo y học: "CD134 as target for specific drug delivery to T cells in adjuvant arthritis" pps

Ngày tải lên : 09/08/2014, 06:22

... scores was found between rats treated with empty anti-CD134 liposomes and rats treated with empty, bare liposomes (data not shown) tion by activated CD4 T cells in vitro Anti-CD134-mediated+targeting ... cells to Mt HSP60211–225, which was reported not to be related to AA [16], indeed indicated that a part of the CD134+ T cells was not activated in relation to clinical disease but responded to ... model, the first signs of clinical disease become manifest between days 10 and 14, and at about this time T cells start to infiltrate the joints [17] The present data therefore suggest that early in...

12
823
0

Báo cáo y học: "Association between regulated upon activation, normal T cells expressed and secreted (RANTES) -28C/G polymorphism and asthma risk – A Meta-Analysis"

Ngày tải lên : 26/10/2012, 09:39

... platelets, macrophages, endothelial cells, fibroblasts, epithelial cells, and mast cells, have the capacity to generate RANTES [8], which directly supported the potential role of RANTES in asthma The ... of RANTES -28C/G associated with asthma risk and to quantify the potential between-study heterogeneity, we conducted a meta-analysis on published case-control studies with 1894 asthma cases and ... and case-control studies of ethnicity (1894 cases and 1766 controls) were available for this meta-analysis The χ2-based Q statistic test was used for the assessment of heterogeneity, and it was...

7
525
0

Tài liệu Báo cáo khoa học: "Using Smaller Constituents Rather Than Sentences in Active Learning for Japanese Dependency Parsing" docx

Ngày tải lên : 20/02/2014, 04:20

... we use the notation {s, t, “D”} to denote that the s-th bunsetsu modiﬁes the t- th one The use of “O” instead of “D” indicates that the s-th does not modify the t- th That is generating {s, t, “D”} ... means vectors which are selected in the training phase and contribute to the prediction Thus it is very important to construct models for estimating the actual annotation cost as Haertel et al (2008) ... not true in an actual annotation work.8 In addition, we have to note that it may be easier to annotate a whole sentence than some bunsetsu pairs in a sentence9 In a real annotation task, it...

10
432
0

Tài liệu David prefers to live in the country rather than live in the city doc

Ngày tải lên : 26/02/2014, 00:20

... chu t vào t để bi t thể loại t t câu: (Các bạn kích chu t lần vào t để bi t thêm chi ti t từ đó) David prefers to live in the country rather than in the city 2 Các bạn di chu t vào cụm t ... “in the city”- thành thị - rather than - là: Trong “ rather trạng t (abverb) có nghĩa là, thích …hơn than liên t ( conjunction) có nghĩa hơn(để diễn đ t so sánh) Ở “ rather than dùng cấu trúc ... prefers to live in the country rather than live in the city Hình thức ngữ pháp : Cấu trúc “ prefer to something rather than (do) something else” – ( thích làm việc việc kia) Chúng ta quan s t câu...

5
597
0

Báo cáo Y học: Role of three isoforms of phospholipase A2 in capacitative calcium inﬂux in human T-cells pot

Ngày tải lên : 08/03/2014, 09:20

... IV and type VI) Interestingly, addition of TG stimulated the induction of the four PLA2 isotypes in Jurkat T- cells PLA2 inhibitors that inhibit AA release diminish the TG-induced capacitative calcium ... inhibited the TGinduced release [3H]AA almost with the same order of magnitude as BEL Figure shows that Jurkat T- cells constitutively express the mRNA of four PLA2 isotypes (type IB, type V, type ... impregnated with ethidium bromide The RNA pattern was visualized by UV transillumination Statistical analysis Results are shown as mean ± SEM Statistical analysis of data was carried out using STATISTICA...

7
483
0

Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx

Ngày tải lên : 16/03/2014, 14:20

... 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢; ... CCTCCTCACCGGATCCTCCACCTCCAGAACCACCACCCCC-3¢; primer 13, 5¢-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3¢; primer 14, 5¢-CGTCTCCTCA GGGGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3¢ In all ... 5¢-CGAATGC GGCCGCAGCTGATGCTGCACCAACTGTATCC-3¢ and reverse primer 5¢-CGAATGCGGCCGCACACTCATTCC TGTTGAAGCTCTTGAC-3¢ The PCR product for the CL(j) region was digested with NotI and cloned into the NotI...

14
493
0

Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf

Ngày tải lên : 23/03/2014, 15:21

... proteins, but also to quantitatively investigate protein– protein interactions The recruitment and localization of LAT and LAT-binding proteins to the sites of receptor activation has been extensively ... sufﬁcient for TCR-mediated MAP kinase activation [17] This indicates that recruitment of the Grb2–Sos complex to the plasma membrane, via its association with LAT at these sites, is not sufﬁcient for ... previously, that these molecules closely, but indirectly, associate with LAT [51] In contrast, SLP-76 demonstrated substantial FRET with Nck, indicating that SLP-76 binds directly to this protein [51]...

10
457
0

Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Ngày tải lên : 24/03/2014, 03:21

... respectively The NFAT-Luc reporter was constructed by inserting an oligonucleotide encoding the NFAT binding site of the FasL promoter (5¢-ATTGTGGGCGGAAACTTCCAG-3¢) with additional GATC motifs at the ... the FasL promoter Therefore, it is possible that the activities of RA are mediated through transcriptional modulation by other nuclear transcriptional factors, such as NFAT and SP-1 To test this ... translation initiation site, and transcription starts from nucleotide )181 [22] (B) Each reporter construct was transiently transfected into Jurkat cells Transfected cells were stimulated with PMA (25...

9
481
0

Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx

Ngày tải lên : 24/03/2014, 04:21

... EcoRI, and ligated into EcoRI digested pGEX- 2T vector The SLP-76-Pro–GST plasmid was constructed using the primers 5¢-CGAGGGATCCCT GCAGAACTCCATCCTGCCTG-3¢ and 5¢-CATTTAAT GAATTCTCTTCCTCCGC-3¢ corresponding ... Shb–PTB–GST plasmid was constructed using the primers 5¢-GGGATCCTTCCAGGACCCCTAC-3¢ and 5¢-AGAATTCAGGGCTCCCATGTTT-3¢ corresponding to the Shb cDNA nucleotides 840–1740 The ampliﬁed fragment was digested ... found that Shb associates with the SH2 domain of SLP-76, but not to the proline-rich regions of SLP-76 (Fig 2D), and that this association was increased by CD3-stimulation To test this further,...

10
408
0

Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx

Ngày tải lên : 28/03/2014, 22:21

... levels of T- bet, and Itk may regulate the expression of this critical transcription factor Indeed, it has been suggested that Itk regulates T- bet levels in iNKT cells in the thymus, and that thymic ... activation may be due to regulated by Itk Depiction of the signaling pathway used by the TCR and cd T cells Note that in the case of the TCR, these pathways seem to be but lead to different developmental ... restrains Given that both cell types can secrete IL-4, it is likely that the production of this cytokine, and the T- cell types that can produce it, need to be tightly controlled Like iNKT cells, ...

10
454
0

17% of cell phone owners do most of their online browsing on their phone, rather than a computer or other device pdf

Ngày tải lên : 29/03/2014, 20:20

... samples The response rate estimates the fraction of all eligible respondents in the sample that were ultimately interviewed At PSRAI it is calculated by taking the product of three component rates: ... options as the main reason why they primarily use their phone to go online, with 6% saying that they not have access to a computer and 4% saying that they not have any other source of internet ... Contact rate – the proportion of working numbers where a request for interview was made Cooperation rate – the proportion of contacted numbers where a consent for interview was at least initially...

16
336
0

Báo cáo khoa học: Receptor- and calcium-dependent induced inositol 1,4,5-trisphosphate increases in PC12h cells as shown by ﬂuorescence resonance energy transfer imaging pot

Ngày tải lên : 30/03/2014, 03:20

... cells was slightly, but significantly, larger than that in untreated cells (P < 0.05, t- test), whereas the receptor-induced portion of the Ins(1,4,5)P3 increase was significantly smaller in Tg-pretreated ... increase was 79.6 ± 7.4% of that induced by reintroduced calcium, whereas for the pretreated cells it was, 39.8 ± 3.0%, which was significantly lower (P < 0.01, t- test) than for untreated cells The ... it is likely that the same effect may account for the finding that the total Ins(1,4,5)P3 increase induced by receptor activation and calcium entry was slightly larger in the absence than in the...

11
419
0

ESPON 2013 DATABASE QUALITY RATHER THAN QUANTITY… potx

Ngày tải lên : 30/03/2014, 22:20

... descriptors covered by the metadata profile: Information about the dataset as a whole: contact information, dataset title and abstract, etc Information about each indicator in the dataset: name, ... implemented by the computer science research team LIG, but it is important to note that other partners and experts of the project contributed to this work In particular, the UAB team has contributed ... the studied topic In this phase, the thematic expert assesses whether the indicators and values present in the dataset are well described, whether the completeness of the dataset is satisfactory...

62
167
0

a universe from nothing why there is something rather than nothing

Ngày tải lên : 05/06/2014, 11:24

... exist to explain the motion of material in our galaxy, we find that the ratio of total matter to visible matter is not to , but closer to to If this is not a mistake, then the dark matter cannot ... during the lifetimes of the greatest astronomers, and Kepler certainly fits the bill Starting out as a humble mathematics teacher in Austria, Kepler became assistant to the astronomer Tycho Brahe ... quite stopping Determining the amount of dark matter, and thus the total density of mass in the universe, therefore promised to reveal the answer to the age-old question (at least as old as T...

208
293
0

a universe from nothing - why there is something rather than nothing - lawrence m. krauss

Ngày tải lên : 11/06/2014, 12:02

... find that the ratio of total matter to visible matter is not to 1, but closer to 10 to If this is not a mistake, then the dark matter cannot be made of protons and neutrons There are just not enough ... and those that are twice as far away are moving twice as fast, those that are three times away three times as fast, etc.—it seems obvious what this implies: We are the center of the universe! As ... during the lifetimes of the greatest astronomers, and Kepler certainly fits the bill Starting out as a humble mathematics teacher in Austria, Kepler became assistant to the astronomer Tycho Brahe...

133
260
0

báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx

Ngày tải lên : 18/06/2014, 15:20

... as the percentage of the total population of CD8+ T cells that were double positive (CD8+pentamer+) Cytotoxicity assays The cytotoxicity assays were performed by flow cytometry CTL assay that ... factors in the supernatant inhibit the maturation of fusion cells and have a negative impact in the stimulation of T cells To determine the induction of WT1-specitic CD8+ T cells, a pentameric assay ... caspase-3 activation in target cells through detection of specific cleavage of fluorogenic caspase-3 [36,37] The fusion cells could prime naive T cells to differentiate into CTL with lytic activity...

19
459
0

báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot

Ngày tải lên : 18/06/2014, 15:20

... Cytotoxicity of In Vivo Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination (the time point associated with the ... production of T cells that not recognize tumour cells in vivo based on this epitope [67-69] In contrast to these studies, the ability of our vaccination strategy to generate tetramer+ CD8 +T cells specific ... substantial generation of tetramer+, CD8+, T cells In fact, the responses generated to the two DC preparations were atypical only in this particular patient The remaining patients showed the pattern...

23
439
0