t cell recognition of microbial lipoglycans and glycolipids

... sensitive test for antigen-specific T cell activity [15] By this method, we found the region around mutation K103N to be reactive to T cells in of the 10 subjects using 18-mer 103N mutant peptides ... positioned within the epitope The reactivity of such a short peptide suggests that the response is due to CTL activity [8] Page of (page number not for citation purposes) AIDS Research and Therapy 2006, ... prediction tool [16,17] It is interesting to note that subject also carries an A23 allele and demonstrated responses against this region resistant variants [21] but did not assess the RT 103...

Ngày tải lên: 10/08/2014, 05:20

... clonotypes of melanoma patients Further biases were the frequent association of this public motif with TRBV28 and TRBJ1-5 segments and the lack of rearrangement with members of TRBJ2 cluster The ... put into the characterization also of tumor Ag-specific TRs Several data demonstrated a major role of TRAV than TRBV chains in TR-Ag recognition, due to the higher number of contacts of this chain ... ATACCA GGGAC TAGGA 39 GCCTGGAGTGT C C CAGGG CTAGG NA XXXXXXAGT CAT CAGGG ATTGGG 16 GCCAGCA CCCT GACAGGG CTTGGA 6E4 GCCAGCAGTTT TCT 40 GCCAGCAGTTTA B/22 GCCAGCAGT C A .ACAGGG TTTGGG 41 GCCAGCAG...

Ngày tải lên: 18/06/2014, 15:20

... differentiate into Th1 and Th2 cells, which secrete distinct sets of cytokines Studies on CTLA-4 expression of differentiated Th1 and Th2 cells have been performed mostly in Th1 and Th2 long-term T cell ... inflammation, the stimulation of antigenexperienced T cells is, at least partly, independent of CD28 signalling, putting CTLA-4/CD80 and CTLA-4/ CD86 into the spotlight of the CTLA-4Ig treatment Furthermore, ... activation of target cells; on the other, blockade of CTLA-4 abrogates the inhibitory function of Treg cells [72] Interestingly, naive T cells, converted to Treg cells by retroviral transduction with the...

Ngày tải lên: 09/08/2014, 01:23

... Discussion The results of our ex vivo study strongly suggest a contrasted picture of T cell activation in allergic rhinitis and asthma, with distinct patterns of Th1, Th2 and Treg profiles and expression ... is still unexplored The objective of this study was therefore to compare the pattern of T cell activation between allergic rhinitics and asthmatics upon allergen stimulation and to assess the ... of the allergens contained detectable amounts of LPS Specific stimulation of T cells Optimal dose of stimulatory pDerp1 and kinetics of T cell cytokine secretion and proliferation were determined...

Ngày tải lên: 12/08/2014, 13:22

... University of Stuttgart, Pfaffenwaldring 47, D-70569 Stuttgart, Germany email: uwe.rau@ipe.uni-stuttgart.de List of Contributors xiii J Neil Ross, Department of Electronics and Computer Science, ... at latitude 22.5"N and the Tropic of Capricorn at latitude 22.5"s give a broad definition to the zone The equatorial radiation climate is quite different in nature to the climate produced by the ... choosing the optimal tilt and orientation of collectors requires careful thought Design also has to deal with the assessment of the effects of site obstruction on collection performance Partial shading...

Ngày tải lên: 18/04/2014, 12:31

... interests Authors' contributions JK carried out the CTL induction, killing assays and drafted the manuscript TT and YH participated in the design of the study and performed the evaluation of the data ... as target cells P(-) indicates T2 -A24 target cells without peptide pulsation K562 target cells were used for monitoring natural killer activity and lymphokine-activated non-specific cytotoxicity ... thymus are mainly cortical thymocytes, but not medullary epithelial cells or dendritic cells that mediate negative selection and T- cell tolerance It may explain at least in part the incomplete...

Ngày tải lên: 18/06/2014, 15:20

... interests Authors' Contributions Authors contributed equally to the intellectual content of this review article Disclaimer The views presented in this article not necessarily reflect those of the ... patient-isolation measures as well as by broad-spectrum antibiotics and antiviral regimens with or without administration of corticosteroids [44,45] Since then, the wealth of information that ... humans The fact that high titers of virus neutralizing antibody to SARS-CoV are found in sera of patients recovering from infection and that those infected with the virus show improvement after...

Ngày tải lên: 19/06/2014, 08:20

... interests Authors' Contributions Authors contributed equally to the intellectual content of this review article Disclaimer The views presented in this article not necessarily reflect those of the ... patient-isolation measures as well as by broad-spectrum antibiotics and antiviral regimens with or without administration of corticosteroids [44,45] Since then, the wealth of information that ... humans The fact that high titers of virus neutralizing antibody to SARS-CoV are found in sera of patients recovering from infection and that those infected with the virus show improvement after...

Ngày tải lên: 20/06/2014, 04:20

... till date It’s probable that the association of granulosa cell tumor and the use of tamoxifen for breast cancer is just a random observation and there is no relationship between them As mentioned ... receptor modulators (SERMs) that have estrogen agonist activities on bone and serum lipid metabolism, and estrogen antagonist activities in mammary tissue in ovariectomized rats [25-27] Treatment ... receiving tamoxifen therapy with a past history of breast carcinoma No explanation was provided for the occurrence and that was only the second case in the literature despite that the tamoxifen...

Ngày tải lên: 09/08/2014, 03:22

... curative primary treatments of BCAC Consent Written consent for publication was obtained from all of the patients before C-ion RT in our institution Table Literature Review of Treatment Results ... Terminology Criteria for Adverse Events (CTCAE) v3.0 Results All of the patients underwent C-ion RT without an interval, and all of the patients were alive at the last observation date No patient ... CT imaging alone is inadequate for detection of extension of the tumor Therefore, MRI was routinely used for identification of the tumor, after fusing it with the planning CT Determination of...

Ngày tải lên: 09/08/2014, 09:20

... involved in the analysis of the data and the literature research, and he also wrote the manuscript SB helped with the patient management and revision of the manuscript TM helped with the literature ... helped with the literature research NI helped with modifications and revision of the manuscript MG helped with the analysis of the data HE approved the treatment and analyzed the literature data All ... of this association of multiple cancers that we report could be hereditary factors and genetic predisposition, but we not have information about the familial history of our patient Otherwise this...

Ngày tải lên: 10/08/2014, 23:20

... attention to multitumor patients, and patients who are at low risk for SCCHN with regard to age or carcinogen abuse Methods and Patients Patients The study consists of 91 consecutive patients ... collected the patient’s samples and isolated DNA MW wrote parts of the article, collected samples and investigated patients AC and TKH collected samples and investigated patients HB and JS corrected ... [20] In this group of patients, they did not detect any truncating mutation Therefore, we were able to confirm these results Nevertheless, they found the missense I15 7T mutation in 4.1% of the cases...

Ngày tải lên: 11/08/2014, 07:21

... a strategy to limit growth of pathogens and other algal species and thereby reduce competition This hypothesis is supported by the potent antimicrobial activity of poly P against bacteria and ... study and drafted the manuscript NA participated in the design of the study and revised the manuscript critically for important intellectual content FMF carried out the design of the study and ... Competing interests The author(s) declares that there are no competing interests Authors' contributions TPW carried out the experimental work and the data analysis, participated in the design of the...

Ngày tải lên: 12/08/2014, 05:20

... demonstrated that p300, a cellular acetyltransferase that regulates chromatin conformation through the acetylation of histones, also acetylates IN and controls its activity [28] Acetylation of C-terminal ... post-entry inhibitor of lentiviral infection, a truncated SR-family protein This factor inhibits infectivity of primate lentiviruses (but not that of MLV) early post-entry by disrupting the stability ... In this work, Sattentau evaluated the contributions of the cellular trafficking machinery (vesicles and cytoskeleton) and identified a vesicular compartment that could contribute to cell- tocell...

Ngày tải lên: 13/08/2014, 09:20

... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...

Ngày tải lên: 16/02/2014, 09:20

... addition to the primary structure of the peptide To confirm our hypothesis that the b-turn structures are important for the inhibitory activities of the peptides, the structures of the cyclic peptides ... patterns, indicative of a stable major conformer at the experimental temperature The structure of peptide cER NMR data of cER indicated the possibility of the b-turn structure in peptide cER The ... inhibitory activity of the cEL peptide and the very low inhibitory activity of the cYT peptide compared to other peptides The flanking residue of the b-turn, i.e Tyr3 of the cVY peptide appears to...

Ngày tải lên: 19/02/2014, 13:20

... TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third ... encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen ... interest in these molecules in the treatment of several pathologies and because of the potential use of the toxins as biological weapons Alteration of their MHC and TCR binding capacity by site...

Ngày tải lên: 07/03/2014, 16:20

... averaged, and the negative control subtracted The short half-life of 32P necessitated determination of the specific radioactivity of the phosphate at the time of the assay from the Ôtotal radioactivityÕ ... Consequently, tyrosines located on the peptides may be expected to exhibit the same kinetics as those located on the intact protein Therefore, determination of the kinetics of phosphorylation of these ... phosphorylation of His-cTCRf tyrosine 1N with time of incubation with Lck The levels of fragment (containing tyrosine 1N) detected with and without phosphate, after 0, and 30 of incubation with Lck...

Ngày tải lên: 08/03/2014, 02:20

... stimulation was also investigated This was the tyrosine phosphorylation of STAT3/STAT5, monitored through binding of anti-(phospho-tyr-STAT3/STAT5) Ig As Fig 5B shows, stimulation of the Kit225K6 ... orientation of IL-2R subunits seems essential to docking and activation of STATs, we investigated here whether raft integrity is a necessary condition to a proper transduction of cytokine-stimulated ... These antibodies detect nonphosphorylated and phosphorylated Tyr moieties on STAT3/STAT5, respectively, without appreciable cross-reaction with other Tyr-phosphorylated STATs After washing, cells...

Ngày tải lên: 17/03/2014, 23:20

... that both cytokine and TCR signaling may affect regulatory T- cell differentiation, it will be of interest to see the role of the TFKs in regulating the differentiation of this subset Together, these ... expressed by the differentiation of CD4+ T cells into distinct effector T cells These subsets include Th1, Th2 and Th17 cells, which produce different cytokines that drive distinct types of immune ... pathways In this regard, the TFKs have come to the light for their roles as potential regulators of cytokine production downstream of TCR stimulation Such studies reveal that mutation of the TFKs...

Ngày tải lên: 28/03/2014, 22:21